Full text of "Rhodora"

See other formats

Journal of the

CONTENTS

Reflections on 100 years of Rhodora. Janet R. Sullivan

New England Botanical Club

A review of the =<ee —— of Hackelia venusta ieceeurese
Ri EG

chy J. Harrod, Lauri A. Malmquist, and Robert L. Carr ............ 16
Myriophyllum — (Haloragaceae), a rare lowland watermilfoil
olivia. Garrett E. Crow and Nur P. Ritter 28
Distribution and — of submerged aquatic vegetation beds in a Con-
necticut harbor. Todd A. Randall, John K. Carlson, and Matthew E.
roczka 40
The distribution of the bryophytes and vascular plants within Little Dollar
ake Apt Mackinac County, Michigan. C. Eric Hellquist and
Garrett E. Cro 46
NOTE
More molecular evidence for interspecific relationships in Liguidambar
(Hamamelidaceae). Jianhua Li and Michael J. Donoghue .......... 87
BOOK REVIEW
The Savage Garden 92
NEBC MEETING NEWS 95
Information for Contributors 101
NEBC Membership Form 103

NEBC Offficers and Council Members

MISSOURI BOTANICAL

MAY 0 4 1999

GARDEN LIBRARY

Vol. 101 Winter, 1999
Issued: April 19, 1999

inside back cover

No. 905

The New England Botanical Club, Inc.

22 Divinity Avenue, Cambridge, Massachusetts 02138

RHODORA

JANET R. SULLIVAN, Editor-in-Chief
Department of Plant Biology, University of New Hampshire,
Durham, NH 03824
ANTOINETTE P. HARTGERINK, Managing Editor
Department of Plant Biology, University of New Hampshire,

Durham, NH 03824
Associate Editors
HAROLD G. BROTZMAN STEVEN R. HILL
DAVID S. CONANT THOMAS D. LEE
GARRETT E. CROW THOMAS MIONE

K. N. GANDHI—Latin diagnoses and nomenclature

RHODORA (ISSN 0035-4902). Published four times a year (January,
April, July, and October) by The New England Botanical Club, 810
East 10th St., Lawrence, KS 66044 and printed by Allen Press, Inc.,
1041 New Hampshire St., Lawrence, KS 66044-0368. Periodicals
postage paid at Lawrence, KS. POSTMASTER: Send address

changes to RHODORA, PO. Box 1897, Lawrence, KS 66044-8897.

RHODORA is a journal of botany devoted primarily to the flora of North
America. Monographs or scientific papers concerned with systemat-
ics, floristics, ecology, paleobotany, or conservation biology of the
flora of North America or floristically related areas will be considered.

ACCREDITED with the International Association for Plant Taxonomy
for the purpose of registration of new names of vascular plants (ex-
cluding fossils).

SUBSCRIPTIONS: $75 per calendar year, net, postpaid, in funds paya-
ble at par in United States currency. Remittances payable to RHO-
DORA. Send to RHODORA, P.O. Box 1897, Lawrence, KS 66044-
8897.

MEMBERSHIPS: rege! $35; Family $45; Student $25. Application
form printed herein

NEBC WEB SITE: Information about The New England Botanical Club,
its history, officers and councillors, herbarium, monthly meetings and
special events, annual te student award, and the journal RHO-
DORA is available at http://www.herbaria.harvard.edu/nebc/

BACK ISSUES: Questions on availability of back issues should be ad-
dressed to Dr. Cathy A. Paris, Department of Botany, University of
Vermont, Burlington, VT 05405-0086. E-mail: cparis@
moose.uvm.edu.

ADDRESS CHANGES: In order to receive the next number of RHO-
DORA, changes must be received by the business office prior to the
first day of January, April, July, or October.

RHODORA, Vol. 101, No. 905, pp. 1-15, 1999
REFLECTIONS ON 100 YEARS OF RHODORA

JANET R. SULLIVAN, Editor-in-Chief

One hundred years ago the New England Botanical Club began
publication of its journal, Rhodora (volume 1, number 1 was
published in January, 1899). The Editor-in-Chief was Benjamin
Lincoln Robinson of Harvard University. He was assisted by As-
sociate Editors Frank Shipley Collins, Merritt Lyndon Fernald,
and Hollis Webster, and members of the Publication Committee,
William Penn Rich and Edward Lothrop Rand. The first issue of
the journal comprised 20 pages of text and two plates, and was
distributed to approximately 600 subscribers who had paid $1.00
each for the year’s 12 issues.

That first issue of Rhodora opened with an editorial announce-
ment (Editorial 1899) outlining the purpose of the journal (“‘...
with confidence that it will give new stimulus and render material
aid to the study of our local flora.”) and describing the types of
articles to be published. The expectations seem modest but inclu-
sive and are clearly stated: that .. Special attention will be
given to such plants as are newly recognized or imperfectly
known within our limits, to the more precise determination of
plant ranges, to brief revisions of groups in which specific and
varietal limits require further definition, to corrections upon cur-
rent manuals and local floras, to altitudinal distribution, plant as-
sociations, and ecological problems.” It was the intention of the
editors to consider all contributions dealing with the “‘... flow-
ering plants, ferns, mosses, and thallophytes ...”’; presumably
they intended to include the gymnosperms, as well. The an-
nouncement also states that ““A decided preference will be given
to articles which embody some newly observed fact, tersely stat-
a

The contents of the first issue encompass the angiosperms, fun-

i, and algae, with short papers and notes on rattlesnake plantains
(Fernald 1899), Myosotis collina (Williams 1899), Sanicula (Brai-
nerd 1899), fringed gentian (Deane 1899), wild lettuce (Robinson
1899), Matricaria discoidea (Manning 1899), algae (Collins
1899a), and fleshy fungi (Webster 1899). It is interesting to note,
in these days when we are so conscious of the importance of peer
review and the avoidance of conflict of interest, that all four of

2 Rhodora [Vol. 101

the editorial staff members were contributors to this first issue!
Like a club newsletter might, the issue includes a listing of new
NEBC officers, reports of meetings of other botanical clubs in
New England, and a request for subscribers to report on the oc-
currence of inland populations of halophytes. The final announce-
ment in the issue is a sort of “‘coming attractions,” describing
articles promised for the early issues of Rhodora and making an
appeal for the submission of announcements of local floras in
preparation.

During the period of the celebration of the Club’s centennial
in 1996 I became intrigued by the events that had transpired so
long ago, resulting in a club and a journal I had respected, ad-
mired, and enjoyed since starting my formal study of botany in
college in the 1970s. The year of the Club’s centennial was also
my first year as Editor-in-Chief of Rhodora; by the end of this
year I had a new appreciation of what is involved in the produc-
tion of a scientific journal. What activities of the Club’s members
warranted such an undertaking? Why did the NEBC decide to
publish what was then a monthly journal?

INITIATING PUBLICATION OF A BOTANICAL JOURNAL

The New England Botanical Club was established in February
of 1896 “for the promotion of social intercourse and the dissem-
ination of local and general information among gentlemen inter-
ested in the flora of New England” (Minutes of the 3rd Club
meeting, February 5, 1896). By December of that year the mem-
bers judged that the endeavor had been successful: the ‘‘faithful
workers in the cause of botany,”’ having been isolated previously,
were meeting monthly, except during the summer, to share con-
versation and information about the New England flora as well
as about new research and developments of botanical and eco-
logical interest worldwide. In addition, the members of the Club
ha en true to their goal of providing ‘‘an elaboration of the
New England flora,” by accumulating specimens for the Club’s
herbarium (now NEBC), and by stimulating interest among the
membership to provide local floras and plant lists. At the annual
meeting in December, 1896, it was stated that ‘‘A plan for con-
solidating the information thus secured will shortly be presented
to you.” It was apparently from this interest in the dissemination

1999] Sullivan—Centennial Reflections 3

of information about the flora of New England that the idea of
publishing a botanical journal evolved.

By the fall of 1897 (Minutes of the 8th Council meeting, Oc-
tober 22, 1897), Dr. B. L. Robinson announced that Mr. E S.
Collins “... had his marine algae in such shape as to be ready
to submit his list to the members of the Club before incorporating
it in the checklist of New England plants.’”’ There were several
local floras already in existence when the Club was organized
two winters earlier, and the members had begun accumulating
plant lists to be incorporated into a checklist of New England
plants. In May and June of that year, Robinson’s Publication
Committee had requested help from the members in accumulating
information for a checklist, particularly with verifying specimens
and literature accounts. The effort to put together a checklist not
only increased the holdings of the Club’s herbarium, but even-
tually led to the publication of Rhodora and the revision of
Gray’s Manual of Botany

The announcement that FE S. Collins was close to being able

to submit his list for distribution sparked “. .. an exhaustive ex-
amination of the various systems of multiplication of writing
.”’ By vote, the Council approved “‘... that Dr. Robinson in-

eubigaie the possibilities of getting pain papers to be submit-
ted to the Club, hektographed by an assistant and that Mr. Collins’
list be hektographed for distribution as an experiment provided
the rate of cost be satisfactory ...’’ [The hektograph was a pre-
decessor of the spirit duplicator. Invented during the 1870s, it
used a stiff gelatin pad and an aniline dye ink to produce copies.]

By February of 1898 (Minutes of the 10th Council meeting,
February 21, 1898), the members of the Council were seriously
discussing the publication of a ‘‘. .. Bulletin to publish botanical
results arrived at by members of the Club and to become the
organ of Descriptive Botany in New England.” Dr. Robinson was
ready to bring the matter before the Club in a formal proposal
The motion to appoint a committee to explore the possibility of
producing a publication was carried unanimously at the Club
meeting on March 4. At the next Council meeting (Minutes of
the 12th Council meeting, March 23, 1898) Robinson presented
an exhaustive report by the Publication Committee, and it was
recommended that two members be appointed as a Financial
Committee to investigate what support might be available for a
serial publication. At the April meeting of the Club, E. L. Rand

4 Rhodora [Vol. 101

submitted a report by the committee which reviewed the different
ways the publication could be supported, and recommended that
not less than 400 subscriptions be obtained. The committee felt
confident that the journal could be published without likelihood
of failure with this number of subscriptions, and that “*... any
deficiency of income during the early stages could Veiadiliy be
met.’ Members of the Club present at the meeting exhibited a
great deal of interest in the suggested publication.

In the Club scrapbook there is an unsigned, handwritten report
dated ‘‘abt Mar 1898” which outlines the details of the —
recommended by the Publication Committee. It specifies a ‘
monthly issue of 16 pages and cover ... with iepivalieckes: to
consist of six plates per year to be assigned free of charge to
authors whose articles seem most in need of illustration . . .”’ The
report also notes the attributes desired of the first cover page,
with *‘.. . the other three pages of cover to be used for advertising
when appropriate and dignified advertisements are available.”
These advertisements were later to prove controversial, and soon
were dropped from the journal.

The original proposal recommended that each author receive
25 free reprints of articles exceeding one page. The cost of the
publication, including wrapping and mailing of 500 copies, was
estimated to be $550.00 for the first year, although this was
crossed out and $600.00 was penciled in above. The cost of an
annual subscription was set at $1.00.

In April of 1898, a printed circular was distributed to the mem-
bers of the Club announcing that the publication of a monthly
journal was being considered, and requesting the assistance of
Club members in obtaining subscriptions (Figure 1). The note
accompanying the flier suggested that an average of 10 subscrib-
ers procured by each resident member (meaning members resid-
ing within 25 miles of Boston, where monthly meetings were
held), and five by each nonresident member would assure the
necessary financial support of the publication.

y the June meeting of the Council (Minutes of the 14th Coun-
cil meeting, June 23, 1898), E. L. Rand reported that 450 sub-
scriptions had been taken, and Robinson asked that the matter of
organization of an editorial board be brought to a vote. The Coun-
cil was in favor of immediate action and appointed B. L. Rob-
inson as Editor-in-Chief, and F S. Collins, M. L. Fernald, and
Hollis Webster as Associate Editors. This editorial board, in con-

a L. Goopa - nt.
peg R. psimncles - Vice- President.
Emice F. Wituiams, - - - Treasurer

[6661

Epwarp L. Ranp, Cieaciaiine Secretary.

Mew England Botanical Cfub.

THE NEW ENGLAND BOTANICAL CLUB is considering the publication of a monthly journal, to begin January
1, 1899. It is to be an octavo of about sixteen pages each issue, and illustrated by full-page plates. It will deal
primarily with the flora of New England, especial attention being given to rare plants, extended ranges of distribution,
and newly introduced, as well as newly described, species. Articles have been already promised by many of the fore-
most New England e tanists, both professional and amateur, and, while a hen standard will be maintained in the
matter of scientific accuracy, nee ae technicality of style will be carefully avoided, so that any person who can use
‘Gray’s Manual’? will be able to read the proposed journal with pleasure ea Interest. Not only the eile plants
and ferns, but fleshy fungi and other cryptogams, will receive attention, The price of the journal has been fixed at
one dollar per annum

While more than two hundred subscriptions have already been promised in advance, the Club does not feel
warranted in proceeding with its plan of publication unless assured of much further support. All persons interested
in botany and in the maintenance of such a journal in New England, are earnestly solicited to send at once sub-
scriptions for at least one year (which, however, need not be paid before January 15, 1899), to

EDWARD L. RAND,
Corresponding Secretary N. E. Botanical Club,
740 Exchange Building,

APRIL 15, 1898. Boston, Mass.

suonoapyoy [eTuusyueDj—urearns

Copy of a flier announcing the New England Botanical Club’s intention to begin publication of a monthly journal

igure 1.
and soliciting subscriptions. -

6 Rhodora [Vol. 101

junction with the already established Publication Committee, was
charged with the responsibility of making the business arrange-
ments necessary.

ce the editorial board was established, the Council discussed
the name of the journal; in an informal vote the name ‘‘Rhodora’”’
was chosen unanimously, but it was decided to defer the matter
to a vote of the Club. At the October Club meeting (October 7,
1898) E. L. Rand reported to the members present that over 600
subscriptions had been secured, “‘... thereby insuring the finan-
cial support deemed necessary for a beginning.’’ The editorial
staff had “*... assumed the responsibility of the business of the
journal ...”’ and Dr. Robinson was called upon to state what had
been done in regard to naming the journal. “In response .. . Dr.
Robinson said the name of the journal had been given the most
earnest consideration from the time the project was first dis-
cussed. He explained the very great advantages resulting from the
use of a single name, not only as being more direct and definite
in the minds of the botanical public, but as being vastly more
convenient for the purposes of citation.’’ He described the infor-
mal vote in favor of ‘““Rhodora”’ at the June meeting of the Coun-
cil, and there followed “*. . . a good deal of discussion among the
members in regard to the name proposed.” There were strong
opinions on both sides of the issue, and the matter was deferred
for final action to the next meeting of the Club.

At the 27th Club meeting on November 4, 1898, the subject
of a name for the journal was again taken up. There was a great
deal of discussion, during which several names were proposed,
and eventually an informal ballot was taken. Jesse Greenman was
appointed by the Chair to collect the ballots and report the results
(Figure 2). ““Mr. Rich, seconded by Mr. Kidder, then moved that
the Club adopt the name ‘Rhodora, Journal of the New England
Botanical Club,’ as the official title of the proposed publication

and the motion was carried with only one or two dissenting
votes.’

Thus the journal was underway, after a year of formal discus-
sion and preparation. The Club ended its third year on a high and
hopeful note; the members felt secure that the new journal would
be self-sustaining, at least at the start, and that its publication
“... would reach far and wide, not only our non-resident mem-
bers ... but also the great botanical world, who knows us not.”
In the summary statements closing the meeting, the new journal

1999] Sullivan—Centennial Reflections 3

i 8 :
\ Pee live ;

Vk "

das gue ow atthe

Figure 2. Tally of votes taken on the name of the new journal (from the
Minutes of the 27th Club meeting, November 4, 1898).

was noted as the highlight of the Club’s achievements: ‘‘.. . the
Club now has a voice ... It remains for the members to make
that voice heard for the best interests of our favorite science and
the result we hope will justify the establishment and maintenance
of the Club. This is a momentous period for us and the prosperity
and perhaps even the existence of the Club will depend upon the
faithfulness with which each one contributes to the success of our
undertaking. The labor we have undertaken is great, but as mem-
bers of the New England Botanical Club, we should be untrue to
our aims and ideals if we did not make the effort to attain them.”

These powerful and encouraging words still ring true today;
while the existence of the Club may not depend on the publication
of the journal, both the existence and quality of the journal still
depend primarily upon the contributions and dedication of Club
members.

PUBLISHING A BOTANICAL JOURNAL

The work had only just begun. The editorial staff and many
other members of the Club spent the first year of the journal’s
publication encouraging the submission of manuscripts, soliciting
new subscriptions, obtaining advertisements to help defray costs,
and working to maintain the monthly publication schedule.

Publication costs were higher than originally anticipated, due
to the decision to electrotype each page. In addition, the inclusion
of an index had not been part of the original calculations, and

8 Rhodora [Vol. 101

toward the end of the first year it was estimated that the deficit
might be as much as $200. In April of 1899 (Minutes of the 18th
Council meeting, April 21, 1899) the Council voted to cover the
expense of publishing the New England Checklist ($35), includ-
ing providing one set of reprints free to each member of the Club.
Emile Williams was appointed to obtain subscriptions adequate
to meet the journal’s deficit for 1899. Over the next few years
Rhodora consistently ran a deficit, and regular appropriations of
funds were made by the Club to support the journal, sometimes
at the expense of increasing the holdings of the Club’s herbarium.
Nevertheless, the subscription rate was not raised until 1912,
when the price of receiving the year’s issues went from $1.00 to
$1.50 per year.

In those early years, the journal carried advertisements to help
defray the costs of publishing plates. Both W. P. Rich and E. L.

and had addressed the Club, describing to the members the de-
sirability of securing advertisements in order to enable the editors
to increase the number of pages and to publish more and better
plates. The earliest advertisements were for booksellers, collec-
tions of dried and live plant specimens, and the ‘“‘Nurseryman’s
Directory.”’ After the excursion to Mount Katahdin by five NEBC
members in July 1900, an advertisement appeared offering ‘‘Ka-
tahdin on Horseback” (volume 3, 1901). The charge for a 4” X
3/4” space was quoted as $4.00 per year (volume 5, 1903).

The largest ads, running from one to four full pages, were
purchased by the Bangor & Aroostook Railroad and offered rail
passage to remote plant collecting sites. These ads immediately
proved controversial, because they itemized locations of rare spe-
cies in addition to offering safe, comfortable passage. An editorial
published in volume 3 (Editorial 1901) defended the ads and the
naming of rare species, stating that the plants in question were
abundant at the sites to be visited, and adding that some of the
species mentioned were considered weeds by farmers or were
timber pests. The ads continued to be published during 1901, but
the controversy led to diminishing numbers of ads of all kinds
over the next few years and advertising was dropped from the
journal by volume 9 (1907).

From a scientific standpoint, the Club’s members were ‘entirely
satisfied’ with their new journal. The early volumes of Rhodora
were filled with short papers and notes outlining the distribution
of particular species in the New England states, describing “‘note-

1999] Sullivan—Centennial Reflections 9

worthy specimens” with unusual morphology, and providing ad-
ditions to the checklist. One of the most quaint — described
the effects of an inadvertent Boletus poisoning at a brunch held
at the home of one of the editors, E S. Collins pee 1899b),
and argued for better identification manuals for the region’s flora.

The journal also featured short articles detailing meetings, field
trips, and histories of other botanical clubs in New England, such
as the Connecticut Valley Botanical eae the Josselyn Botan-
ical Society, the Vermont Botanical Club, and the Boston My-
cological Club. Short book reviews and gaa started ap-
pearing in volume 2, as well. Longer articles commemorating the
lives of deceased Club members each featured a formal portrait
and signature.

Volume 3 devoted a considerable number of pages to a diary
kept of the botanical excursion to Mount Katahdin the year before
by five members of the Club (Churchill 1901). The editors also
allowed publication of seven plates accompanying this article. In
addition, members of the party contributed four other articles on
the botanical aspects of the trip (Collins 1901; Fernald 1901;
Kennedy and Collins 1901; Williams 1901). This was the begin-
ning of a tradition of publishing botanical commentaries on Gray
Herbarium and New England Botanical Club expeditions.

Originally, the scientific articles published in Rhodora were
mostly field observations, though the results of laboratory exper-
iments and study of herbarium specimens started appearing in
very early issues. Although notes of one or a few paragraphs
continued to be a feature of the journal for many years, the length
of articles and their scientific content increased significantly over
the first few years of publication.

Nevertheless, manuscripts were difficult to come by in those
early years. The members of the editorial staff were frequent con-
tributors to the early issues; a glance at the index to volume 1
shows that Robinson wrote four articles and notes, Collins wrote
five, Fernald wrote 15, and Webster wrote eight. The items con-
tributed by the editors amounted to 28% of the total published
that year; the percentage was almost as high for volume 2 (25%).
This must have been a considerable burden for the editors; B. L.
Robinson addressed the problem at a Club meeting, asking the
members “... to bear in mind Rhodora which is much in want
of copy ...” (Minutes of the 45th Club meeting, October 5,
1900). After a few years the journal had a group of supporters

10 Rhodora [Vol. 101

who submitted articles regularly, and in 1929 it was noted that
articles by 399 different botanists had been published in Rhodora
(Editorial 1929). By the 1940s the number of pages published
per year had increased considerably, as had the number of plates.

By far the most prolific contributor to the journal was Merritt
Lyndon Fernald. An apparently tireless researcher, Fernald pub-
lished an average of 13 articles and notes per year (range 4—25)
from the time the journal was established until his death in 1950.
He also served on the editorial board during this entire period,
first as an Associate Editor (1899-1928) and then as Editor-in-
Chief (1928-1950) after the resignation of B. L. Robinson. His
contributions encompass the full spectrum of types of articles
published in the journal during its first 52 years; commentaries
on botanical expeditions, notes on the distribution of taxa, floristi
and taxonomic treatments, descriptions of new species and vari-
eties, details of anomalous plant distribution and morphology, and
descriptions of new plant collecting techniques all can be found
among the papers he wrote for Rhodora. One may wonder wheth-
er the journal could have survived the early paucity of manuscript
submissions if it had not been for Fernald’s contributions.

In addition to the variation in availability of publishable ma-
terial, the journal suffered an inevitable fluctuation in subscrip-
tions. As late as 1928 members of the NEBC Council were still
struggling to improve circulation. Originally, having a subscrip-
tion to Rhodora was not tied to membership in the Club. [It was
not until 1968 that women were admitted to the NEBC as mem-
bers, and not until 1996 that membership was automatic upon
application.] It was expected after the first year of publication
that there would be a “considerable falling off in subscriptions,
many of the first year’s subscribers finding it altogether above
their interest and understanding.” The list of original subscribers
surely included some who fell into that category, but the sub-
scription list also must have expanded beyond New England fair-
ly early. At the end of the first year (volume 1, number 12), W.
P. Rich called for a prompt renewal of subscriptions, listing the
cost as “‘$1.00 per year for the United States and Canada, $1.25
for other countries.” Manuscripts were contributed by botanists
from outside of New England almost from the start; as early as
volume 2 a note appeared by William M. Canby of Wilmington,
Delaware (Canby 1900), and in volume 3 a note was published
by Charles Bessey of the University of Nebraska (Bessey 1901).

1999] Sullivan—Centennial Reflections 11

In volume 21, FE S. Collins published the first article about plants
occurring outside of North America (Collins 1919). Back issues
were already scarce by volume 3, and a special notice published
in 1901 encouraged interested readers to send the $1.50 necessary
to secure a copy of the fast-disappearing issues of volume 1. “
early response will be necessary ...’’ warned the editor.

In 1900 (volume 2) the fectenel fell behind in its publication
schedule because of a fire at the printing office. “It appears that
the entire April issue was destroyed, but as full sets of proofs had
been printed and sent the issue will be immediately reprinted with
a delay of perhaps three weeks.’’ (Minutes of the 41st Club meet-
ing, April 6, 1900). Luckily, the plates had been stored in a vault
and were unharmed by the fire. The journal continued to appear
on a monthly basis, more or less on schedule, until 1962 when
publication was changed to a quarterly schedule. At this time the
subscription rate was raised to $6.00 per year.

RHODORA TODAY

In some ways the business of publishing a botanical research
journal has not changed in the past 100 years, and in other ways
it has changed dramatically. We still suffer fluctuations in suitable
manuscript submissions and journal circulation, and we still need
to maintain a regular publication schedule to satisfy both our
subscribers and the U.S. Postal Service. Beyond that, however,
the original editorial staff of the journal probably would be
amazed at the changes in the complexities of the process. The
papers published in Rhodora today involve more experimental
results than pure description, reflecting that trend in botanical
research over the past fifty years. The degree of specialization in
research necessitates enlisting the help of reviewers beyond the
editorial board. The papers published today are longer than those
in the early issues of the journal, and typically include tables and
figures. Likely, it has been the increased level of detail in man-
uscripts, combined with the use of word processors rather than
secretaries, that has contributed to the workload and, thus, to the
decreasing tenure of editors of Rhodora (Figure 3), despite the
redistribution of some of the more tedious tasks among the press
and editorial board members. Certainly, the authors and members
of the Club and its council could not have been any more en-

Number of Years
ct

Robinson Fernald Rollins Hodgdon Bogle Tryon Nickerson DeWolf Conant
Editors

re 3. Illustration oa the trend in decreasing tenure of Editors of Rhodora. When two Editor’s terms overlap each has been
eauted off to the full yea

elopoyuy

TOT ‘T°A]

1999] Sullivan—Centennial Reflections 13

couraging and supportive in the early years than they have been
during my term thus far!

In addition to reflecting changes in the field of botany, Rhodora
reflects the changes that have occurred in the membership of the
New England Botanical Club. In its early years, the Club mem-
bership consisted of an approximately equal mixture of amateurs
and professionals; in a 1995 survey 75% of the respondents listed
themselves as students or professionals having employment re-
lated to botany. In addition, the early members of the Club were
mostly ‘“‘resident’? members; that is, members who lived within
25 miles of Boston. By the time Fernald assumed the position of
Editor-in-Chief, the journal boasted 33 Old World subscribers
(Editorial 1929). Today the Club’s membership and subscribers
range worldwide, and manuscripts are regularly submitted from
outside of the U.S. One of the regular features of the journal,
NEBC Meeting News, attempts to keep distant members in-
formed of the content of our monthly seminars.

When he took on the job of Editor-in-Chief, Fernald began his
term by publishing an overview of the accomplishments of the
journal’s first 30 years (Editorial 1929). At that time, it was rea-
sonable to relate such statistics as the number of new and total
contributors per volume, and to name some of the more faithful
contributors. Since then, many new, more specialized periodicals
have begun publication, drawing papers away from the more gen-
eral botanical journals such as Rhodora. Still, the journal has
maintained publication of high quality papers on a variety of top-
ics in botany. In addition, the elimination of page charges in 1996
has made publication in the journal more accessible to students
and professionals with limited funds.

In his 1929 editorial announcement, Fernald took the oppor-
tunity to restate quite eloquently the parameters within which
manuscripts should fit in order to be appropriate for publication
in Rhodora: “The pages of Rhodora are not reserved ... for
members of the Club. They are freely open to all who care to use
them, especially for the publication of tersely stated notes on

nge extensions or new or unrecorded facts regarding habits,
morphology, habitats or other features of interest to students of

1 pl . or the natural history of plants. Systematic revisions
and monographs of groups represented in the flora of northeastern
North America will be welcomed for editorial consideration and
well-written and descriptive (but not prolix) accounts of explo-

14 Rhodora [Vol. 101

rations, containing a good share of new or significant observa-
tions, will be gladly considered. Mere lists without clear statement
of the significance of the records are less desirable. Illustrations
of new species and of newly recognized diagnostic characters are
most desirable ... Photographs of landscapes, unless they are
remarkably sharp vind of patent significance to the discussion, are
undesirable for reproduction and, in general, Rhodora cannot
commit itself to publish them. ... Manuscripts which show se-
rious lack of consistency will necessarily be returned for correc-
tion. In case of misquotations, erroneous citations and other in-
accurate details in manuscripts the editors will naturally make
corrections of obvious errors. They cannot, however, be expected
to specially check such matters and it will be inferred that authors
have themselves verified such essential details. Neither can the
editorial board be held responsible . . . for all statements and con-
clusions presented by different authors. In the case of controver-
sial subjects, with the desire to present both sides of a question,
papers may be accepted for publication, though not representing
the views of the editors.’” While the possibilities may seem a bit
limited by today’s standards, Fernald could not have anticipated
the full range of submissions, especially the range of experimental
techniques, available to researchers 70 years later.

The details of the discussions 100 years ago on the name of
the new journal were not recorded in full. We know that Taxus
was suggested in jest, and we know the other, serious consider-
ations that were included in the vote. Apparently, some members
felt that the name “Rhodora’”’ was “too sentimental,” perhaps
because of the poem by Ralph Waldo Emerson, although that
connection has not been mentioned elsewhere. Apparcotly, some
members with more limited vision felt that the name ‘““Rhodora”’
would be appropriate for a club whose members had a primary
interest in plants with the same range (Editorial 1929; Howard
1996; Pease 1951). Whatever the thoughts of those 26 voting
members in 1898, Rhodora now serves readers worldwide and,
while concentrating on the flora of North America, information
on related taxa and comparable ecological phenomena from be-
yond that limit are considered for publication.

ACKNOWLEDGMENTS. I am indebted to the members of the New
England Botanical Club, especially the Council members and ed-

1999] Sullivan—Centennial Reflections 15

itorial staff, who have provided so much encouragement and sup-
port during my three years as Editor.

LITERATURE CITED

Bessey, C. E. 1901. Baptisia tinctoria as a tumbleweed. Rhodora 3: 34—35.

BRAINERD, E. 1899. The saniculas of western Vermont. Rhodora 1: 7—9.

CanBy, W. M. 1900. Coreopsis involucrata on the Atlantic coast. Rhodora
2: 34

CHURCHILL, J. R. 1901. A botanical excursion to Mount Katahdin. Rhodora
3: 147-160.

COLLINS, - S. 1899a. Notes on algae.—I. Rhodora 1: 9-11.

———.. 1899b. A case of Boletus poisoning. Rhodora 1: 21-23.

1919. Chinese marine algae. Rhodora 21: 203-207.

CoLuns, J. E 1901. Notes on the bryophytes of Maine,—II. Katahdin mosses.

Rhodora 3: 181-184.
Deane, W. 1899. A prolific fringed gentian. Rhodora 1: 11.
EpIToRIAL. 1899. Editorial announcement. Rhodora 1: 1-2.
. 190 3-284

———.. 1929. Editorial announcement. Rhodora 31:
FERNALD, M. L. 1899. The ee. -plantains of New England. Rhodora
ae Le

1. The vascular plants of Mount Katahdin. Rhodora 3: 166-177.

KENNEDY, G. G. AND J. E COo..ins. 1901. Bryophytes of Mount Katahdin.
odora 3: 177-181.

MANNING, W. H. 1899. Matricaria discoidea in eastern Massachusetts. Rho-
dora 1: 1

Pease, A. S. 1951 . The New England Botanical Club a half-century ago and
later. Rhodora 53: 97-105.

RosInson, B. L. 1899. A new wild lettuce from eastern Massachusetts. Rho-
ora 1: 12-13.

WessTER, H. 1899. Notes on some fleshy fungi found near Boston. Rhodora
1: 13-18.

WILLIAMS, E. E 1899. Myosotis collina in New England. Rhodora 1: 11-12.
———.. 1901. A comparison of the floras of Mt. Washington and Mt. Ka-
tahdin. Rhodora 3: 160-165.

RHODORA, Vol. 101, No. 905, pp. 16-27, 1999

A REVIEW OF THE TAXONOMIC STATUS OF
HACKELIA VENUSTA (BORAGINACEAE)

Ricuy J. HARROD AND LAurRI A. MALMQUIST

USDA Forest Service, Leavenworth Ranger District,
600 Sherbourne, Leavenworth, WA 98826

ROBERT L. CARR

Department of Biology, Eastern Washington University,
Cheney, WA 99004

ABSTRACT. Morphological variables were sear using principal com-
ponents and discriminant analyses to determine patterns of relationships
among populations of Hackelia venusta, a narrow w endemic, and H. diffusa

with the population from the type locality at a low elevation clearly distinct
from high elevation populations that have been assigned to this species. The
high elevation populations represent an undescribed taxon. No affinities with
either the low elevation H. venusta or the high elevation undescribed taxon
were found to exist with populations of H. diffusa var. arida. Both H. venusta
and the undescribed high elevation taxon are very narrow endemics and
would benefit from well-developed conservation strategies and subsequent
management.

Key Words: Hackelia, taxonomy, rare species

Hackelia venusta (Piper) St. John, showy stickseed, is a narrow
endemic species of the Boraginaceae currently known only from
Chelan County, Washington. As described by Gentry and Carr
(1976), the species is a moderately stout perennial, 2—4 dm tall,
often with numerous, erect to ascending stems from a rather slen-
der taproot. It has large, white, showy flowers. The nutlets are 3—
4.5 mm long, with 8-14 intramarginal prickles. The marginal
prickles are fused for up to % their length, forming a flange ca.
1 mm wide. It is found on steep, rocky slopes covered with gra-
nitic scree.

The species was first described by Piper (1924) in the genus
Sree and was later transferred to Hackelia by St. John (1929).

original description given by Piper was based on a 1920
eee made by J.C. Otis (895, Us) at a site about seven miles
northwest of Leavenworth in Tumwater Canyon at an elevation

1999] Harrod et al.—Hackelia venusta 17

of 488 meters. Piper described H. venusta as having a white co-
rolla about 2 cm broad. In 1947, a specimen (Long 14, ws) was
collected about 16 km south, southwest of the Otis collection in
the Alpine Lakes Wilderness, Chelan County, at an elevation of
2030 meters. Subsequently, researchers (Carr 1974; Gentry and
Carr 1976; Hitchcock et al. 1959) included this alpine collection
in their circumscription of the species and noted that flowers are
white or sometimes washed with blue. Since that time, three ad-
ditional alpine populations assumed to be H. venusta have been
located, one from an area near the Otis collection (Harrod 238,
Leavenworth Ranger District Herbarium), one from Asgaard Pass
(plants have not been relocated since 1995, Harrod unpubl. data)

and the other from Cashmere Mountain, all above 2000 meters
within the Alpine Lakes Wilderness area.

Some recent workers have suggested that the high elevation
populations may be taxonomically distinct from the Tumwater
Canyon Hackelia venusta (Gamon 1988; Loyal A. Mehrhoff,
USFWS, Portland, OR, and Kathleen Robson, Robson Botanical
Consultants, Vancouver, WA, pers. com.). The purpose of this
study was to evaluate the relationship of these populations in
order to achieve a better understanding of the taxonomic status
of H. venusta. Because of the possibility of some allopatric in-
trogression between H. venusta (sensu stricto) and populations of
H. diffusa (Doug. ex Lehmann) Johnston var. arida (Piper) Carr
in the lower end of Tumwater Canyon and several coulees north
of Leavenworth (Carr 1974; Gentry and Carr 1976), a number of
populations of the H. diffusa var. arida were included in the
study.

MATERIALS AND METHODS

Study sites. Data were collected from ten populations in
Washington shown on the map in Figure 1. Collection sites for
Hackelia venusta (sensu lato) were located on the Wenatchee Na-
tional Forest in Tumwater Canyon (TC), 9.6 km west of Leav-
enworth, 488 meters; Crystal Creek (CC), 19.0 km southwest of
Leavenworth, 2030 meters; and on Cashmere Mountain (CM),
16.0 km southwest of Leavenworth, 2073 meters. Collection sites
for Hackelia diffusa var. arida were located on the Wenatchee
National Forest in Tumwater Canyon (TW), 1.6 km west of Leav-
enworth, 400 meters; Derby Canyon (DE), 11.3 km southeast of

18 Rhodora [Vol. 101

;
Vv
CRYSTAL
CIRQUE
A Low elevation H. venusta
N
V High elevation H. venusta A
© H. diffusa var. arida

Figure 1. Locations of the populations of Hackelia examined in this
study.

Leavenworth, 730 meters; Burch Mountain (BM), 4.8 km north-
west of Wenatchee, 400 meters; Swakane Canyon (SC), 19.3 km
northeast of Wenatchee, 1188 meters; and on the Ponderosa Es-
tates Special Interest area (PE), 17.7 km north of Leavenworth,
670 meters. Two sites were located on Bureau of Land Manage-
ment land; in Moses Coulee (MC), 24.0 km north of Quincy, 152
meters; and Douglas Creek (DC), 26.0 km north of Quincy, 140
meters.

Benson 02).

1999] Harrod et al.—Hackelia venusta 19

Morphological characters. Characters selected generally
follow those used by Gentry and Carr (1976). Nineteen morpho-
logical characters from three categories were scored for statistical
analysis (vegetative, floral, and fruit) and an additional 11 qual-
itative characters were recorded (Table 1). At each site, 25 plants
were chosen randomly, numbered, and tagged. The Cashmere
Mountain site, however, supports a small population and only 14
plants were selected. From each plant, one radial (basal) leaf and
two cauline leaves, one from the lower one-third and one from
the upper one-third of the stem, were chosen randomly for mea-
surement. Three flowers and three fruits were chosen randomly
and measured on each plant.

Statistical analyses. Both principal components and discrim-
inant analyses were performed on the quantitative morphological
data (SYSTAT 1997, SPSS Inc., Chicago, IL). Principal compo-
nents analysis (PCA) was used to show natural groupings among
each sampling unit or operational taxonomic unit (population).
PCA is a method of partitioning a resemblance matrix into a set
of perpendicular components (Ludwig and Reynolds 1988). Each
component or axis has a corresponding eigenvalue which is the
variance accounted for by that axis. The eigenvalues of the matrix
are separated in descending order of magnitude so that each PCA
component represents successively lesser amounts of variation
(Ludwig and Reynolds 1988). The first component is the linear
combination of variables accounting for more variance in the data
than any other possible combination. The second component is
the linear combination of the remaining variance after the first
component is accounted for, the third component is the best linear
combination after the first and second components have been ac-
counted for, and so on. The data for the PCA involved the entire
data set of a 238 X 19 character matrix (Table 1).

Discriminant analysis was used to establish the nonarbitrariness
of group assignments. This analysis places each case within the
group (population) with which it shares discriminating characters
(Anderson and Taylor 1983). Unlike PCA, discriminant analysis
is biased in that it positions cases within the ordination based on
discriminating characters to achieve maximum separation of pre-
viously defined groups. The case distributions were plotted by

two discriminant functions that separated the assigned groups to

Table 1. Morphological characters used in the taximetric analysis of Hackelia venusta and H. ae var. arida. All measure-
ed

ments in mm unless otherwise no

Vegetative

Floral

Fruit

Plant height (dm)

Radial leaf length

Radial leaf width

Radial leaf petiole |

Radial leaf shape fet

Radial leaf surface (descriptive)

Lower cauline leaf length

Lower cauline leaf width

Lower cauline leaf shape (descriptive)
Lower cauline leaf surface (descriptive)
Upper cauline leaf length

Upper cauline leaf width

Upper cauline leaf shape (descriptive)
Upper cauline leaf surface (descriptive)

Pedicel —

Calyx len

Calyx a (descriptive)
Limb width

Corolla aa (descriptive)
Anther len

Fornice Soak (descriptive)
Fornice appendage height
Fornice protuberance length

Nutlet shape (descriptive)

Nutlet surface (descriptive)
Nutlet length

Number - intramarginal prickles
Flange w

Distinct pickle ‘aug

Fraction connat

viopoyy

IOI ‘I°A]

1999]

Table 2. Means and standard deviation (in ee of characters used

in the present study. cept ns a tid. is

Measurements ar

Harrod et al.—Hackelia venusta

e given in mm,

in dm. ‘Abbreviations of the quantitative characters listed 1 in Table

Blue-flowered White-flowered or. cele
Hackelia venusta Baca venusta
Character! =2 = 1
Floral
Ped 3.7 (1.42) 6.3 (1.88) 4.4 (1.84)
Clx 3.0 (0.43) 3.8 (0.54) 2.4 (0.50)
LimWid 4.2 (0.72) 7.4 (1.84) 4.3 (0.98)
th 0.9 (0.13) 1.0 (0.15) 1.0 (0.52)
For/Ap 1.0 (0.14) 1.3 (0.20) 0.6 (0.20)
r/Pr 0.8 (0.19) 1.5 (0.31) 0.7 (0.32)
Fruit
NutL 5.6 (0.85) 6.4 (0.88) 6.2 (1.14)
#InPr 10.2 (2.86) 11.4 (2.92) 10.1 (3.93)
FIW 1.8 (0.34) 1.9 (0.38) 15 :(0:52)
DPL 1.2 (0.25) 1.1 (0.76) 1.0 (0.53)
FrCon 0.4 (0.11) 0.5 (0.08) 0.3 (0.12)
Vegetative
Height (dm) 1.4 (0.35) 2.7 (6.74) 5.1 (1.40)
REL 56.9 (16.36) 48.9 (11.6) 98.6 (41.0)
RL:W 14.4 (4.60) 11.3 (4.08) 8.8 (4.00)
RL:Pet 21.9 (9.50) 32.2 (10.4) 63.3 (26.4)
CLE 28.8 (6.64) 37:3 CEL.O) 83.2 (23.3)
CLL:W 9.2 (2.85) 7.4 (2.00) 4.5 (1.62)
CLUE 15.0 (5.67) 20.1 (6.50) a1 (13.3)
CLU:W 6.5 (2.26) 6.6 (2.40) 3.7 (1.60)

the greatest ability. Again, the data for this analysis involved the
same 238 X 19 character matrix used in the PCA.

Qualitative characters were not subjected to statistical analyses,
but are used for further discussion and description.

RESULTS

The means and standard deviations for the quantitative char-
acters are presented in Table 2 for each putative taxon. The Crys-
tal Creek and Cashmere Mountain populations, which were blue-
flowered, consistently had smaller floral measurements than the
white-flowered Hackelia venusta of Tumwater Canyon. However,
there were no consistent differences between these populations
and the H. diffusa var. arida populations; there is considerable

22 Rhodora [Vol. 101

variability in floral size among populations of this latter, complex
taxon. Fruit characteristics tended to be similar among all popu-
lations. The Tumwater Canyon H. venusta were taller in stature
than the Crystal Creek and Cashmere Mountain populations, but
similar to all populations of H. diffusa var. arida that were ana-
lyzed. Leaf characteristics were variable, with the Tumwater Can-
yon H. venusta having the shortest radial leaves but intermediate
in leaf length for the upper and lower cauline leaves. The Crystal
Creek and Cashmere Mountain populations had the widest radial
and lower cauline leaves.

Radial leaf and nutlet measurements were missing from a num-
ber of cases at the conclusion of the study. These characters were
dropped from both the principal components and discriminant
analyses since the program would ignore those cases with missing
data.

ponents that accounted for all the variance, the first three ac-
counted for 68.0% (38.5%, 18.3%, and 11.2%, respectively). The

H. diffusa var. arida.

Finally, there was considerable overlap in the Hackelia diffusa
var. arida cases with no distinct groups (Figure 2). However, there
is some separation based on populations; the Swakane Canyon,
for example, is separated from Ponderosa Estates and Derby Can-
yon populations.

1999] Harrod et al.—Hackelia venusta 23

3 T T T
Soi.
sc DE
sc
DE
2 TW pc DE DE i
om MSE
D&c sis Tw
sc DE pc
E pc PE mc DE
TC
ae Mc BYE c pc DE
DE
@ sc BMsc p¢ tW TRE OME
—
| Sg aii mc_MC DE i
5 MC DEDE Be
= sc me 5 Cc DE
x Oo, vo ae : pETC aa
BM PE
‘Say tw DC Mc, Miu rc TC
ave Mc PE peer P Tc TC
sc CMM PE Tc
Cc TC
cc ar PE PE . tye
| p= cyec ce TC
cc coc MS TC
PECM
GMC pe x< %. ©
ae cc RE TC
ce ce orc PE 7c TG@c
ome
ay | | | | |
-3 -2 -1 0 1 2 3
FACTOR(1)

Figure 2. Ordination of populations of Hackelia examined in this study
based on scores of principal components | and 2. The first two components
accounted for 56.8% of the total variance (38.5% and 18.3%, respectively).

diffusa var. arida: BM = Burch Mountain, TW = Tumwater Canyon; SC
= Swakane Canyon, PE = Ponderosa Estates, MC = Moses Coulee, DE =
Daly, Canyon, DC = Douglas Creek; H. venusta (white-flowered form): TC

= Tumwater Canyon; H. venusta (blue-flowered form): CM = Cashmere
Mountain, CC = Crystal Creek.

Discriminant analysis. Table 3 gives the variables used and
their relative usefulness in discrimination. The characters that
contributed most, in order of importance, were height, fornice
appendage height, fornice protuberance length, and limb width.
Figure 3 shows the population centroids plotted on the basis of
two (out of 9) of the most discriminating functions. Functions 1
and 2 accounted for 85.2% of the ability to distinguish amon
groups (72.9% and 12.3%, respectively). The total peidinasbisity

24 Rhodora [Vol. 101

Table 3. Variables used in discrimination analysis #1 and their usefulness
in discrimination among populations.

Function coefficients (+)

F (to
Variable Function 1 Function 2 remove)

Pedicel length 0.019 0.158 5.42
Calyx length 0.271 0.189 2.78
Limb width 0.081 0.480 9.37
Anther len 0.016 0.013 +99
Fornice appendage height 0.604 0.304 34.23
Fornice protuberance length 0.259 0.654 18.45
Plant height 0.659 0.072 48.86
Upper cauline leaf length 0.278 0.264 6.52
Upper cauline leaf width 0.153 0.410 me A |
Lower cauline leaf length 0.163 0.197 5.64
Lower cauline leaf width 0.386 0.228 Se

that a case from a certain population is correctly classified to that
population was 81.0%. Predictability for the Cashmere Mountain
and Crystal Creek populations was 82% and 76%, respectively,
with individuals not showing affinity to each population grouping
with the other. Only two individuals from the Cashmere Mountain
population showed affinity to another population (Tumwater Can-
yon, white-flowered Hackelia venusta). Ninety-two percent of
cases were correctly classified in the Tumwater Canyon popula-
tion. Predictability for the H. diffusa var. arida populations varied
from 71% to 96% with deviant individuals grouping with other
H. diffusa var. arida populations. The PCA showed some sepa-
ration of the Swakane Canyon, Derby Canyon, and Ponderosa
Estates populations, which is corroborated to some degree by the
discriminate analysis (Figure 3). Predictability for the Swakane,
Derby Canyon, and Ponderosa Estates populations was 96%,
83%, and 96%, respectively.

DISCUSSION

tinct from the high elevation collections which apparently rep-
resent an undescribed taxon. We are in the process of completing

1999] Harrod et al.—Hackelia venusta 25

S
zZ ” 4
C)
nN
«5 =
-10 l [ae |
-10 -5 0) 5 10
SCORE(1)

Figure 3. Ordination of populations of Hackelia examined in this study
based on two most discriminating functions. Functions 1 and 2 spew for
85.2% of the ability to distinguish among populations (72.9% and 12.3%
te H. diffusa var. arida: BM = Burch Mountain, TW = Tumwater

; SC = Swakane Canyon, PE = erener Estates, MC = Moses
eee “DE = esnetd Canyon, DC = Douglas Creek; H. venusta (white-
flowered form): TC = Tumwater Canyon; H. venusta (blue-flowered form):
CM = Cashmere See, CC = Crystal Creek.

further studies on these and additional populations. The most ob-
vious morphological distinction between the high elevation and
Tumwater Canyon populations is flower color. The high elevation
plants are always blue, while the Tumwater Canyon plants are
largely white, sometimes with a faint blue tint. This study dem-
onstrates that there are additional morphological distinctions, such
as plant height, fornice appendage height, fornice protuberance
length, and limb width. The high elevation and Tumwater Canyon
populations also occupy markedly different environments, but

26 Rhodora [Vol. 101

both occupy similar substrate, scree derived from granodiorite
and tonalite (Tabor et al. 1987). Additional factors considered
include the absence of intermediate forms between the high and
low elevation taxa and plants remain true to form and color when
grown in a greenhouse (Harrod unpubl. data).

The results of our study do not suggest allopatric introgression
between Hackelia venusta in Tumwater Canyon and H. diffusa
var. arida as had been previously suggested by Gentry and Carr
(1976). Some populations of H. diffusa var. arida do have larger
flowers, but do not approach the size of the Tumwater Canyon
H. venusta individuals. Other characters are also dissimilar. How-
ever, allopatric introgression between H. venusta and H. diffusa
var. arida as posed by Carr (1974) and Gentry and Carr (1976)
can not be ruled out by our study since we found considerable
variability in floral measurements among H. diffusa var. arida
populations. Three populations (Swakane Canyon, Ponderosa Es-
tates, and Derby Canyon) were separated from each other, but not
from other populations of H. diffusa var. arida. The positions of
Ponderosa Estates and Derby Canyon in the PCA and discrimi-
nant ordinations were closer to H. venusta than any other popu-
lations including Swakane Canyon (based largely on floral char-
acteristics). However, it is unclear from our data whether or not
gradation in floral characters within populations of H. diffusa var.
arida are the result of allopatric introgression or simply site dif-
ferences. More information is needed to discover this possible
relationship.

Conservation concerns. The Tumwater Canyon Hackelia
venusta consists of one small population with ca. 150 individuals
located near a major state highway. The population in the early
1970s was estimated to occupy a few hundred acres (Carr 1974;
Gentry and Carr 1976), but has dramatically decreased due to
highway maintenance and habitat loss associated with fire exclu-
sion and subsequent increase in woody vegetation, shading, and
stabilization of scree slopes. This population could be lost due to
random environmental events and, therefore, is severely threat-
ened. In addition, the high elevation populations are also quite
restricted and may be subject to loss from stochastic events. All
three populations would benefit from well-developed conserva-
tion strategies and subsequent management.

1999] Harrod et al.—Hackelia venusta 27

ACKNOWLEDGMENTS. We would like to thank John Gamon,
Loyal Mehrhoff, and Kali Robson for their work showing the
need for addressing this taxonomic problem. We appreciate the
constructive comments Ted Thomas, John Gamon, Kali Robson,
Loyal Mehrhoff, James Miller, and an anonymous reviewer pro-
vided on early versions of this manuscript. Dottie Knecht, Mark
Ellis, Cedar Drake, Ellen Kuhlmann, and Shelly Benson provided
field assistance. We thank Pam Camp for help in locating popu-
lations of Hackelia diffusa var. arida on BLM land. This project
was cooperatively funded by the USFS, USFWS, and the Wash-
ington Natural Heritage Program. Figure 1 was developed by Dan
O’Connor, Wenatchee National Forest.

LITERATURE CITED

ANDERSON, A. V. R. AND R. J. TAYLOR. 1983. Patterns of morphological
variation in a population of mixed species of Castilleja (Scrophulari-
a2.

CARR, an es 1974. A taxonomic study in genus Hackelia in western North
a. Ph.D. Dissertation, ei State University, Corvallis, OR.

GAMON, I. 1988. Habitat Management Guidelines for Hackelia venusta in the
Wenatchee National Forest. Washington Natural Heritage Program,
Olympia,

GENTRY, J. L. JR. AND R. L. Carr. 1976. A revision of the genus Hackelia
(Boraginaceae) in North America, north of Mexico. Mem. New rk

Bot. Gard. 26: 121-227.

Hitcucock, C. L., A. CRONQUIST, M. OWNBEY, AND J. W. THOMPSON. 1959.
Vascular Plants of the Pacific Northwest. Part 4: Ericaceae through Cam-
anulaceae. University of Washington Press, Seattle, WA.

Lupwia, J. A. AND J. EF REYNOLDs. 1988. Statistical Ecology. John Wiley and
Sons, New York.

Piper, C. V. 1924. New flowering plants of the Pacific Coast. Proc. Biol. Soc.
Wash. 37: 91-96.

Sr. Joun, H. 1929. New and noteworthy northwestern plants. Res. Stud. State
Coll. Wash. 1: 104-105.

Sane R. W,, V. A. FrizzeL, Jr., J. T. WHETTEN, R. B. Waitt, D. A. Swan-

NN, G. R. ByerLy, D. B. Bootu, M. J. HETHERINGTON, AND R. E. ZarT-

MAN. 1987. Geologic map of the Chelan 30-minute by 60-minute quad-
rangle, Washington. Misc. Investigations Series, Map I-1661, U.S. Geol.
Survey.

(Outs
RHODORA, Vol. 101, No. 905, pp. 28-39, 1999

MYRIOPHYLLUM MATTOGROSSENSE (HALORAGACEAB),
A RARE LOWLAND WATERMILFOIL NEW TO BOLIVIA

GARRETT E. CROW AND Nur P. RITTER
Department of Plant Biology, University of New Hampshire,
urham, NH 03824
(SOCOVOS
ABSTRACT. Myriophyllum mattogrossense is reported as new to Bolivia.

This rare Watermilfoil of the Amazon Basin was previously known only from
the original area of discovery in Brazil, one locality in the lowlands of Peru,
and one in Ecuador. Notes on morphology, including a terrestrial growth
form, and habitat are given, and a key is provided to differentiate the South
American taxa of Myriophyllum.

Key Words: Myriophyllum, Haloragaceae, Watermilfoil, Bolivia

Since 1994 we have been conducting a broad biodiversity sur-
vey of aquatic and wetland plants in Bolivia. While carrying out
this fieldwork we encountered two small populations of Myrio-
phyllum growing in streams ca. 20 km apart in the Amazon Basin
region of Bolivia, known as the Chapare. The plants were found
growing in swiftly flowing water of small rapids, rooted among
rocks and gravel. These plants were conspicuously different from
M. quitense Kunth (= M. elatinoides Gaud.), the common and
widely distributed species in Bolivia. Although M. quitense is a
common element of high elevation lakes, and is often so abundant
that cattle are driven into the water to feed on it during the dry
season (Dejoyx and Iltis 1991: Ritter and Crow 1998), we had
not found any other populations below 2500 m and were sur-
prised to encounter a Myriophyllum in the lowlands. Another spe-
cies of Myriophyllum, M. aquaticum (Vell.) Verdc. (= M. brasi-
liensis Camb.), is a widespread aquatic weed of tropical and warm

southern Brazil (Orchard, 1981). However in Bolivia, this species
is known only from a newly discovered site in the Interandean

that our material was distinct from M. aquaticum.

We were ultimately able to determine the identity of the plant
in the Chapare as Myriophyllum mattogrossense Hoehne, the first
record known for Bolivia. Until recently, this rare species had
been known only from two locations, one near Cuyaba, Mato

1999] Crow and Ritter—Myriophyllum mattogrossense 29

Grosso, Brazil, upon which E C. Hoehne (1915) based the de-
scription for his new species, and one in the foothills on the
eastern side of the Andes at Tocache Nuevo, Peru (Kahn et al.
1993; Orchard 1981). More recently, M. mattogossense was col-
lected from a third location, near Coca, Ecuador (Orchard and
Kasselmann 1992). Orchard (1981) noted that the species might
well be found eventually in a much wider area of the lower foot-
hills on the eastern side of the Andes of Peru, Brazil, and perhaps
even Bolivia, and attributed the lack of known sites to the sub-
merged habit and inconspicuous flowers.

Moreover, it is our experience that aquatic plants, in general,
are greatly undercollected in the Neotropics. Many aquatic plants
which are rather common are poorly represented in herbaria. Ad-
ditional populations of Myriophyllum mattogrossense surely exist,
but are not likely to be encountered unless the fieldwork is spe-
cifically focused on aquatic plants. This was certainly the case
when Christel Kasselmann, a specialist of aquatic plants for
aquarium culture, collected the first record for Ecuador (Orchard
and Kasselmann 1992). We stumbled onto the first Bolivian pop-
ulation while searching for members of the Podostemaceae, an
aquatic family restricted to rapids and swift flowing waters in
areas with a seasonal fluctuation of water levels. Thus, M. mat-
togrossense is now known from its type locality in Mato Grosso,
Brazil, and in the Amazon Basin near the base of the Andes in
Ecuador, Peru, and Bolivia (Figure 1).

The Chapare region, where the Bolivian populations were en-
countered, borders the eastern slope of the Andes and is notable
for having the highest amount of rainfall in Bolivia, with parts
of the region receiving more than 5000 mm of precipitation per
year (Ribera et al. 1994). The larger rivers and tributaries of the
area experience a high level of disturbance during the rainy sea-
son. River courses in the Chapare are extremely transitory, with
riverbeds receiving large depositions of gravel and sand, and with
new channels frequently being formed while former stretches are
transformed into curiches (oxbows). Streams and other tributaries
can also experience significant disturbance as well. Generally
speaking, the streams in the area are characterized by a lack of
rooted vegetation and haptophytes (Crow and Ritter, pers. obs.).
In the case of Myriophyllum mattogrossense, it appears that a
combination of fairly specific habitat requirements—clear, fast-
moving water and a substrate composed of gravel and cobbles—

30 Rhodora [Vol. 101

Figure 1. Documented distribution of Myriophyllum mattogrossense.

coupled with the transitory nature of aquatic habitats due to se-
vere disturbances, serves to limit the number of populations of
this species.

Previously, this species was believed to be strictly submersed.
Orchard (1981) stated that the species is unusual in that its flow-
ers and fruits are unusually small, and that the plant was reported
to grow completely submersed, resulting in underwater opening
and pollination of the flowers. While we observed the submersed

1999] Crow and Ritter—Myriophyllum mattogrossense 31

plants to be fertile, as did Hoehne (1915), we also observed the
existence of a terrestrial growth form for Myriophyllum matto-
grossense, likewise in fertile condition. The terrestrial growth
orm was initiated as the water level dropped and marginal plants
became stranded (Figure 2). The submersed leaves dried up and
new upright branches sprouted from the prostrate stem. When
seen in this condition, the species had an almost moss-like, or
Hippurus-like appearance (Figure 2). Although this was observed
in both of the Bolivian populations, there was no mention of a
terrestrial growth form on the labels of the Peruvian specimens
examined. However, Kasselmann (Orchard and Kasselmann
1992) observed emergent plants growing on mud along the riv-
erbank, which fit the description of the terrestrial growth form
we observed.

In the Bolivian material the leaves of submersed plants have
segments that, while filiform, are very thin, distinctly flattened,
with a conspicuous midvein, and which are wider than typical for
Myriophyllum quitense. The Peruvian material examined exhib-
ited the same morphology. We were able to examine only one
herbarium specimen of the Ecuadorian material, and while the
submersed leaves were flattened, the segments were much more
filiform than those of either the Bolivian or Peruvian material.
However, they did closely resemble those depicted in the illus-
tration accompanying Hoehne’s (1915) original description, now
serving as the lectotype (Orchard 1981). Previously, we had noted
that the markedly capillary leaf segments in the Brazilian popu-
lation were altogether distinct from those of the other populations.
We were able to reconcile this variation by attributing it to habitat
differences (lacus temporarius in Brazil). Arber (1920) noted that
water plants respond to certain physical stimuli and that in My-
riophyllum, in particular, one can observe marked differences in
the morphology of the same species growing in different current
regimes. In still water, plants may have leaf segments that are
delicate and nearly hair-like, while the stresses of current on the
leaves of plants growing in strongly flowing water require that
leaves tend toward increased mass and thickness (Arber 1920;
Gerber and Les 1994).

In contrast to the submersed plants, the leaves of the terrestrial
form have divisions that, while still somewhat flat, are pectinate
(with fewer divisions), thicker, and distinctly succulent (Figure

32 Rhodora [Vol. 101

Figure 2. Habit of terrestrial growth form of Myriophyllum mattogros-
sense at edge of stream.

Figure 3. Close-up view of terrestrial growth form of Myriophyllum mat-
togrossense showing somewhat flattened, thicker, succulent, pectinate leaves.

1999] Crow and Ritter—Myriophyllum mattogrossense 33

3). The flowers and fruits are axillary on both terrestrial and sub-
mersed plants.

DESCRIPTION OF BOLIVIAN MATERIAL

Plants perennial, herbaceous aquatics, with submerged and ter-
restrial growth forms (Figure 4). Stems and leaves with small
sessile glands; glands moderately dense on young growth, becom-
ing sparse on older growth. Submersed growth form: stems flex-
uous, ascending in quiet water, somewhat horizontal in flowing
water; leaves verticillate, in whorls of 3—4, pinnately divided, ca.
(18—-)20—22(—25) mm long, with 7-8 pairs of lateral segments
(mostly alternate), segments flattened, 0.4—-0.5 mm wide, each
with a distinct midvein; hydathodes filiform, tiny, present at base
of petioles and each leaf segment on young growth. Terrestrial
growth form: stems of submersed plants rooting on stream mar-
gins or gravel bars, submersed leaves withering away; upright
stems arising from axillary buds, not flexuous, sturdy, erect;
leaves verticillate, pectinate, mostly 10-11 mm long, becoming
shorter toward stem tip (4—5 mm long), mostly with 3 pairs of
lateral segments (alternate), segments somewhat flattened, thick-
ish, slightly succulent, each with a distinct midvein (especially
on herbarium material) each segment with an apical secretory
gland; hydathodes filiform, tiny, present at base of petioles and
each leaf segment on young growth. Flowers (both growth forms)
axillary, 1—4 per whorl, bisexual, appearing sessile (pedicel short,
0.25—0.4 mm long), subtended by a pair of bracteoles (apparently
early caducous), frequently with filiform hydathodes on each.
Perianth 4-merous, opposite the ovary lobes, alternate with sta-
mens. Stamens 4, subsessile, anthers ovoid, slightly apiculate at
tip, stamens developing before stigmas, not long persisting. Ova-
ry inferior, 4-lobed, stigmas 4, conical; tiny hydathodes present
at summit of ovary. Fruits globose, 4-lobed, 7-9 mm long, 7-9
mm wide; mericarps with a few weak tubercles on outer surface.

Flowering in this species did not appear to be seasonal. Based
on all specimens examined, flowering material has been observed
on specimens collected in February, March, April, May, June,
and Nov

Orchard and Kasselmann (1992) noted a number of features
evident in the Ecuadorian populations which had not previously
been observed in Myriophyllum mattogrossense, thus expanding

34 Rhodora [Vol. 101

Figure 4. Myriophyllum mattogrossense drawn from submersed growth
form specimens. (A) Section of stem showing axillary flowers, glandular
emergences (appearing as dots) scattered on leaves and stems, and hydathodes
present at leaf bases. (B) Section of young shoot. (C) Young flower with only
stamens evident. (D) Mature flower with stigmas alternating with stamens,
and with subtending bracteole present.

1999] Crow and Ritter—Myriophyllum mattogrossense ee)

the description for the species. These features were, in particular,
the presence of filiform ‘‘hydathodes,” the trichomas collectores
of Hoehne (1915), at the bases of the petioles and at the base of
each leaf segment on young growth; the presence of numerous,
scattered, globular sessile glands on the surface of the young
stems and leaves; and flowers with a complete absence of a peri-
anth. The Bolivian material is consistent with all of these features
with exception to that of the perianth. In the Bolivian specimens
the flowers do possess a single, 4-merous perianth whorl of small
triangular appendages, arranged alternate the styles and opposite
the 4 stamens, the stamens developing first and not persisting. A
further character we noted was the presence of a pair of bracteoles
subtending the flowers (Figure 4), which apparently are caducous,
as they were noted only with earlier stages of flowers. Myrio-
phyllum mattogrossense had previously been described as lacking
bracteoles (Orchard 1981; Orchard and Kasselmann 1992); a lack
of bracteoles is unusual in the family (Orchard and Kasselmann
1992)

The presence of sessile glands is unusual in the genus (Orchard
and Kasselmann 1992), thus the feature can serve as a good di-
agnostic character for Myriophyllum mattogrossense. Since
glands had not been noted on the Peruvian material (Orchard
1981), we re-examined the Peruvian herbarium specimens; glob-
ular sessile glands are, indeed, present.

Recently, some puzzling reports of Myriophyllum mattogros-
sense in the Gran Pantanal of Mato Grosso, Brazil, have appeared
in the literature. Prado et al. (1994) noted that M. mattogrossense
forms “luxuriant beds” during the high water stages in the Pan-
tanal. This species was said to “‘bloom intensively” during this
time, and then to die off. The authors stated that M. mattogros-
sense is “‘easily recognized in the field by its deep red, densely
clustered leaves,” and further noted that the species possesses
emergent flowers which descend below the water’s surface fol-
lowing fertilization (Prado et al. 1994, p. 581). Clearly, red veg-
etation and emergent inflorescences are characters not known to
be associated with M. mattogrossense. Unfortunately, the identity
of their plants cannot be confirmed as no voucher specimens had
been cited.

Heckman (1997) reported Myriophyllum mattogrossense as fill-
ing the niche of submersed plants in the tropical wet-and-dry
climatic zone in South America. In a subsequent book on the

36 Rhodora [Vol. 101

Brazilian Pantanal, he described ‘‘luxuriant submerged beds” of
M. mattogrossense that form in the northern Pantanal during the
high water stage, and included a color photograph of the pre-
sumed M. mattogrossense (Heckman 1998). Having examined
this photograph, we have concluded that the species in question
is clearly not M. mattogrossense.

Although Pott and Pott (1997) included Myriophyllum matto-
grossense in their comprehensive checklist of aquatic plants of
the Brazilian Pantanal, they noted that they have never observed
this species in the Pantanal, and were aware of its presence only
through the original type collections of Hoehne (Vali Pott, pers.
com., 1998). Furthermore, Guarim Neto’s (1992) checklist of an-
giosperms of the Pantanal includes no species of Myriophyllum.
In like manner, during our extensive expedition in 1998 in the
Bolivian portion of the Pantanal we encountered neither M. mat-
togrossense nor any other species of Myriophyllum.

SPECIMENS EXAMINED

fast-moving water, 5 May 1996, Ritter 3147 (LPB, Mo, NHA).

Brazil. Mato Grosso, near Cuyabd. Original specimens of EF C. Hoehne
apparently lost (Orchard 1981). Lectorype: Tabula n. 127 (“Ns. 4.578 e
4.635. Hab. lacus temporarius ad Coxip6 da Ponte, propre Cuyabé”), Comm.
Linh. Telegr. Mato Grosso Amaz., Annexo 5, Bot. 6. 1915.

Ecuador. Rio Coca, 8 Feb 1990, Kasselmann 133 (p). According to Or-
chard and Kasselmann (1992) the site locality is: Rio Yanaucu (lower Rio
Coca drainage) about 20 km north of the town of Coca (Pto. Francisco de
Orellana) at the crossing of the road from Coca to Lago Agrio.

- Department of San Martin: Province of Mariscal C4ceres, al oeste
de vivero del Instituto Agropecuario de Tocache, Tocache Nuevo, elev. 400
m, 10 Nov 1969, Schunke V. 3598 (GH, US).

Peru. Department of San Martin, Province of Mariscal Caceres, Fundo
Jeroglifico, del Sr. Luis Ludefia (Quebrada de Ishichimi), Tocache Nuevo,
elev. 400 m, 10 Apr 1975, Schunke V. 8281 (MO).

Peru. Department of San Martin: Province of Mariscal Caceres, Quebra-
da Ishichimi, cerca al Fundo del Sr. Luis Ludefia, sumergida en las riachuelos,
elev. ca. 400 m, 3 Nov 1980, Schunke V. 12393 (Mo).

1999] Crow and Ritter—Myriophyllum mattogrossense 37

In order to facilitate differentiation of the species of Myrio-
phyllum in South America the following key is provided, includ-
ing information from our expanded understanding of M. matto-
grossense and M. quitense (Ritter and Crow 1998). Additionally,
it is noteworthy that although M. spicatum L. has been listed for
Peru and M. verticillatum L. has been listed for Chile, specimens
bearing those names were based on misidentified specimens (Or-
chard, 1981); these two species are not known to occur in South

KEY TO THE SOUTH AMERICAN SPECIES OF MYRIOPHYLLUM

1. Submersed leaves in whorls of (2—)3—4(—5); segments of sub-
mersed leaves very slender, distinctly flattened, ca. 0.5 mm
wide, with conspicuous midvein, or filiform; emergent
leaves absent on submersed form in reproductive phase
(terrestrial growth form, with ascending aerial branches
sprouting from prostrate stems, may be expected to occur
stranded along water margin; leaves pectinate, mostly 10—
11 mm long, segments mostly 3 per side); leaves and
stems bearing scattered, small, globular, sessile glands (es-
pecially young material); flowers solitary, borne axillary
along submersed portion of stem, (also axillary along erect
stems on terrestrial form); flowers bisexual; stamens 4;

mericarps with a few weak tubercles on outer surface;
rare, lowlands, Ecuador, Peru, Bolivia, and Brazil ......
fie GaN A ieee E.G eck s Ok Sie oe tok ea A M. mattogrossense

1. Submersed leaves in whorls of (3—)4—6; segments of sub-
mersed leaves filiform to only somewhat flattened, mostly
up to ca. 0.25 mm wide, midvein not conspicuous; emer-
gent leaves present on submersed form (terrestrial form
rare in M. quitense, ascending aerial branches sprouting
from prostrate stems, leaves pectinate, mostly 7-10 mm
long, segments 5—6(—8) per side); leaves and stems lacking
glands; flowers in spicate inflorescences, borne in the axils
of the emergent leaves only; flowers unisexual, plant mon-
oecious or dioecious (bisexual flowers on terrestrial form
in M. quitense); stamens 8; mericarps smooth on outer
a ls ie seals nahh o ba Lbns $9 os Kh ae we de bes Z

2. Submersed leaves in whorls of (3—)4(—5), ovate in outline,
1—2 cm long, with 7-9 pairs of pinnae, segments nearly

38 Rhodora [Vol. 101

filiform, somewhat flattened; emergent leaves blue-
green, tinted red or purple, in whorls of (3—)4, ovate to
oblong, more or less entire, at least in upper parts,
toothed to pinnatisect in lower parts; plants monoecious
(flowers bisexual in terrestrial form); Andes from Ven-
ezuela to Tierra del Fuego, e. Argentina, s. Uruguay,
and Falkland Islands, disjunct tae eee in Mexico,
nw. North America, PE.I., Canada ..... M. quitense
2. Submersed leaves in whorls of rence 6, oblanceolate in
outline, (1.7—)3.5—4 cm long, with 12-15 pairs of pin-
nae (lower leaves decaying rapidly); distinctly filiform,
terete; emergent leaves glaucous, in whorls of (4—)5—
6, narrowly oblanceolate, pectinate, with (9—)12—18
pairs of pinnae; plants dioecious (female plants only in
adventive populations); s. Peru, s. Bolivia, and s. Brazil
south to c. Chile, n. Argentina, and pe eh intro-
duced weed northward in Mesoamerica and e.
I oS eC Oe Pe M. cant

ACKNOWLEDGMENTS. We are thankful to Carol Morley for pre-
paring the botanical illustration. Robynn Shannon kindly provid-
ed us with a photocopy of Hoehne’s original description. We are
grateful to Christel Kasselmann for providing us with a living
specimen of Myriopohyllum mattogrossense from Ecuador. Drs.
Thomas D. Lee and A. Linn Bogle reviewed a draft of the man-
uscript and provided helpful comments. The curators of the fol-
lowing herbaria are acknowledged for loans of herbarium speci-
mens: B, GH, MO, and Us. This research was supported in part by
a grant from the Vice President for Research and Public Service,
University of New Hampshire. This paper is Scientific Contri
bution Number 1978 from the New Hampshire Agricultural oo
periment Station.

LITERATURE CITED

ARBER, A. 1920. Water Plants: A Study of Aquatic Angiosperms. Reprint
edition with preface by W. T. Stearn. 1972. J. Cramer. Lehre, Germany.

Desoyx, C., AND A. ILtIs. (eds). 1991. El Lago Titicaca, Sintesis del Cono-
cimiento Limnolygico Actual. ORSTOM, Institut Francais de Recherche
Scientifique por le Development en Cooperation. La Paz, Bolivia.

GerseR, D. T. and D. H. Les. 1994. Comparison of leaf morphology among

1999] Crow and Ritter—Myriophyllum mattogrossense 39

submersed species of pe es niculio ee eee subs different hab-
i r. J. Bot. 973-979

HEckMAN, C. A. 1997. Ecoclimatological survey of the wetland biota i Me the
tropical wet-and-dry climatic zone. Global Ecol. Biogeogr. Lett. 6: 97—
114.

———. 1998. The Pantanal of Pocone—Biota and Ecology in the Northern
Section of the World’s Largest Pristine Wetland. Kluwer Academic Pub-
lishers. Dordrecht, The Netherlands.

Hoeune, FE C. 1915. Commissao de Linhas Telegraphicas, eg ona a
Mato Grosso ao Amazonas. Annexo No. 5. Historia Natural
Ri il

Kaun, F, L. BLANCA, AND K. R. YOUNG. (compiladores). 1993. Las Plantas
Vasculares en las Aguas Continentales del Pert. Inst. Francés de Estudios
Andios. ear Peri

ORCHARD, A 1981. A revision of South American Myriophyllum (Halor-
agac ceae), er its repercussions on some Australian and North American
— Brunonia 41: 27-65.

. KASSELMANN. 1992. Notes on Myriophyllum mattogrossense
alragacse, cae J. Bot. 12: 81-84.

Pott, V. J. AND A. Pott. 1997. Checklist do macr6fitas acudticas do Pantanal,
pad Acta Bot. Brasil. 11: 215-227.

Prapo, A. L. po, C. W. HECKMAN, AND FE B. Martins. 1994. The seasonal
succession ‘of biotic communities in wetlands of the tropical wet-and-

dry climatic zone: II. The aquatic macrophyte vegetation in the Pantanal
of Mato Grosso, Brazil. Int. Rev. Gesamten Hydrobiol. 79: 569-589.

RIBERA, M. O., M. LIEBERMAN, S. BECK, AND M. Mora ces. 1994. Mapa de
la Vegetacién y Areas Protegidas de Bolivia. Instituto de Ecologia. La
Paz, Bolivia.

Ritter, N. P. AND G. E. Crow. 1998. Myriophyllum quitense H.B.K. (Hal-
oragaceae) in Bolivia: A terrestrial growth-form with bisexual flowers.

saa atic Bot. 60: 389-3

. In pr | Primera Se pee de Myriophyllum aqua-
ticum ties en Bolivia. Ecol. Bolivi

RHODORA, Vol. 101, No. 905, pp. 40-45, 1999

DISTRIBUTION AND DENSITY OF SUBMERGED
AQUATIC VEGETATION BEDS IN A
CONNECTICUT HARBOR

Topp A. RANDALL

Gulf Coast Research Laboratory,
P.O. Box 7000, Ocean Springs, MS 39566

JOHN K. CARLSON

University of Mississippi,
Department of Biology, University, MS 38655

MATTHEW E. MrRoczKA

Cedar Island Marina Research Laboratory,
PO. Box 181, Clinton, CT 06417

ABSTRACT. Submerged aquatic vegetation (SAV), Zostera marina and

Key Words: SAV, distribution, Long Island Sound, Clinton Harbor

Submerged aquatic vegetation (SAV) of the North American
Atlantic coastal waters supports highly diverse animal assem-
blages (Heck et al. 1989; Rozas and Odum 1987). Seagrass beds
function as refugia, energy sources, and habitat for the animals
inhabiting the beds (Heck et al. 1989; Sogard and Able 1991). A
decline in seagrass bed production would have profound effects
upon these animal assemblages and would decrease detrital ex-
port, greatly reducing energy sources for other fauna not directly
inhabiting SAV beds (Thayer et al. 1984).

The reduction of SAV in the coastal United States has been
well documented (Kemp et al. 1983: Orth and Moore 1983; Rob-
blee et al. 1991; Thayer et al. 1994). Natural causes of SAV
decline such as disease, storm events, salinity fluctuations, and

1999] Randall et al—Submerged Aquatic Vegetation 41

hypoxic events coupled with anthropogenically induced eutro-
phication currently threaten the production of many SAV com-
munities (Durako and Kuss 1994; Koch and Beer 1996; Monta-
gue and Ley 1993; Olesen and Sand-Jensen 1994; Zieman et al.
1994). Therefore, documenting the distribution of SAV is impor-
tant in developing baseline data which can be used to monitor
abundance patterns and ecological health over extended periods
of time.

The distribution of SAV (Zostera marina L. and Ruppia mar-
itima L.) along the Connecticut coast of Long Island Sound has
been previously documented by Koch and Beer (1996). However,
detailed maps of the extent of seagrass beds within individual
bays and harbors are not available. Historically, SAV has been
reported to occur in Long Island Sound as far west as New York
State but is now limited to the easternmost third of Long Island
Sound (Koch and Beer 1996). Clinton Harbor is considered the
westernmost distribution point of seagrass in Long Island Sound
(Koch and Beer 1996) and was selected as a study site to monitor
changing SAV distribution patterns. The purpose of this study
was to provide baseline information on the density and the dis-
tribution of SAV in inner Clinton Harbor (Clinton, CT).

Clinton Harbor occupies 162 ha and is located on the Con-
necticut shore of Long Island Sound. The harbor is a drowned
river valley inundated by seawater and receives freshwater input
from the Hammock, Indian, and Hammonasset Rivers. Inner Clin-
ton Harbor is the mouth of the Hammonasset River and is formed
by the presence of the Cedar Island spit (Figure 1). The tides
within the harbor are semi-diurnal and display a mean tidal range
of 1.5 meters. Clinton Harbor is a rural harbor with 60% of its
bordering land edge being utilized as wetlands and beaches, 25%
as marinas, and 15% as residential housing (Mroczka 1991).

MATERIALS AND METHODS

SAV densities were measured in inner Clinton Harbor from
August 15, 1990 through October 31, 1990. Inner Clinton Harbor
was divided into 33 transects set at 30 m intervals along the
shoreline. The transect positions were established with survey
equipment, marked with stakes, and subsequently plotted on a
hydrographic survey map.

SAV densities were obtained using SCUBA. Divers moved

INNER
CLINTON
HARBOR

METERS

100

200

Figure 1. Map of inner Clinton Harbor indicating the location — density of submerged aquatic vegetation. Density categories
are expressed as the mean number of short shoots per m? (Low =

O0—20; Medium

= 21-40; High = 41).

eIOpoyy

IOI TOA)

1999] _—_ Randall et al—-Submerged Aquatic Vegetation 43

along a calibrated 200 m line making observations at 15 m in-
tervals. At each interval, SAV short shoot densities were counted
in two randomly placed 0.5 m? grids. Zostera marina and Ruppia
maritima short shoots were not differentiated in the counts.
Counts were adjusted to m? values and the mean of the two counts
was then calculated and used as a datum point for mapping. A
total of 662 sampling points, each sampled once, was used in this
study. SAV distribution was plotted on a survey map (Figure 1)
using the density categories established from percent shoot cov-
erage of a m’ grid. The densities established were categorized as
low (O—20 short shoots per m*), medium (21—40 short shoots per
m7’), and high (=41 short shoots per m7). Area covered (ha) was
then calculated for each density category with a Scalex Planwheel
planimeter.

RESULTS

SAV was documented in an estimated 23 ha of inner Clinton
Harbor. Although Zostera marina and Ruppia maritima shoots
were not differentiated in the counts, the beds were dominated
by Z. marina. Nine areas of low density SAV beds were identified
(Figure 1). The low density beds were distributed throughout the
study area, but were located primarily in areas north of the nav-
igational channel. Low density beds occupied approximately 11
ha. Nine areas of high density SAV beds, occupying appro
mately 6.5 ha, were located laterally along the navigational chan-
nel (Figure 1). Ten areas of medium density beds were also iden-
tified laterally along the navigational channel (Figure 1). Medium
density beds accounted for approximately 5.5 ha of all SAV beds.
The mudfiat along the northern shore of the inner harbor was
unpopulated by SAV, as was the navigational channel.

DISCUSSION

Seagrass beds play integral roles in coastal ecology and have
been suggested to be among the most productive aquatic ecosys-
tems known (Day et al. 1989). Extensive declines in SAV along
the coastal United States in the past few decades have made it
necessary to document and monitor the extent of existing seagrass
beds (Koch and Beer 1996; Olesen and Sand-Jensen 1994). Base-
line data of SAV distribution will provide researchers and re-

44 Rhodora [Vol. 101

source managers with the necessary information to begin to rec-
ognize and interpret the effects of both natural and anthropogenic
impacts on the seagrasses, which will be critical for the future
management of this resource.

The results of our 1990 survey have shown that inner Clinton

Harbor was dominated by low density seagrass beds (Figure 1),
which were located mainly in the areas north of the navigational
channel. This portion of the harbor is dominated by poorly sorted
mud/silt or (Mroczka 1991) and is typically exposed during
peri rmal low tide. High turbidity significantly reduces
light aeaiabitny and the production of the beds throughout this
area.
High and medium density SAV beds were identified in large
aggregations laterally along the navigational channel (Figure 1).
High flow rates of water through the navigational channel keep
the surrounding sediments composed of well sorted sand grains
(Mroczka 1991). High water flow also reduces the turbidity in
the areas surrounding the channel making the water considerably
clearer than that of the mudflats to the north. Water clarity in
these areas permits the critical light level to extend to the bottom,
allowing for more productive seagrass beds (Day et al. 1989;
Duarte 1991).

The lack of SAV within the navigation channel is due to the
depth of the channel and periodic oyster dredging. The 3 m depth
of the navigational channel does not allow sunlight to penetrate
to a level that is conducive to SAV growth (Duarte 1991). Peri-
odic oyster dredging in the channel also precludes the establish-
ment of SAV beds.

Our study provides baseline data on the general distribution of
SAV in inner Clinton Harbor. Future SAV monitoring can be
conducted and subsequently compared to the results of this sur-
vey in order to determine changes in the distribution patterns of
the seagrass beds.

ACKNOWLEDGMENTS. We thank Jeffrey Shapiro and Dr. Peter
Pellegrino for their support of this project. Thanks are also ex-
tended to Stephen Capella and Kimberly Damon for their assis-
tance in SAV counts. We are grateful to J. D. Caldwell, Cynthia
Moncreiff, and Robin McCall for help with the manuscript prep-
aration and review.

1999] Randall et al—Submerged Aquatic Vegetation 45

LITERATURE CITED

Day, J. W., C. A. S. HALL, W. M. Kemp, AND A. YANEZ-ARANCIBIA. 1989.
Estuarine Bestey. Wiley and Sons, New York.

DuartE, C. M. mie Seagrass ng ter limits. Aquatic Bot. 40: 363-377.

Durako, M. J. AND K. M. Kuss. 1994. Effects of Labyrinthula infection on
the nanan tien ace of Thalassia testudinum. Bull. Mar. Sci. 54:
727-732

Heck, K. L., K. W. ABLE, M. P. FAHAY, AND C. T. ROMAN. 1989, Fishes and
decapods of Cape Cod eelgrass meadows: Species composition, seasonal
abundance patterns and comparison with unvegetated substrates. Estu-
aries 12: 59-65.

Kemp, W. M., R. R. TwiLtey, J. C. _ STEVENSON, W. R. BOYNTON, AND J. C.
MEANS. Wig The decline of submerged vascular plants in upper Ches-
apeake B Yee e of results concerning possible causes. J. Mar.

85.

Kocu, E. W. AND . "BEER. 1996. Tides, light and distribution of Zostera
marina in Long Island Sound, USA. Aquatic Bot. 53: 97—107.
MontTaaug, C. L. AND J. A. Ley. 1993. A possible effect of salinity fluctuation
on abundance of benthic vegetation and associated fauna in northeastern
Florida Bay. Estuaries 16: 703-717.

Mroczka, M. E. 1991. An investigation of the finfish utilization of a co ne
marina basin with special emphasis on the winter flounder (Pseudop
ronectes americanus Walbaum). M.S. thesis, Southern Connecticut pine

, New Haven, CT.

OLESEN, B. AND K. SAND-JENSEN. 1994. Patch = see of eelgrass Zostera
marina. Mar. Ecol. Progr. Ser. 106: 147-15

OrtH, R. J. AND K. A. Moore. 1983. eae Bay: An unprecedented
decline in eee aquatic vegetation. Science 222: 51-52.

ROBBLEE, ee B., T. R. BarBER, P. R. Cartson, M. J. DurAKo, J. W. Four-
se , L. K. MUEHLSTEIN, D. Porter, L. A. YARBRO, R. T. ZIEMAN,

Diss Lc. ZIEMAN. 1991. Mass mortality of the tropical seagrass Thal-
es testudinum in Florida Bay (USA). Mar. Ecol. Progr. Ser. 71: 297-

209.

Rozas, L. P. AND W. E. Opum. 1987. The role of submerged aquatic vege-
tation in influencing the abundance of nekton on contiguous tidal fresh-
water marshes. J. Exp. Mar. Biol. Ecol. 114: 289-300.

SocarD, S. M. AND K. W. ABLE. 1991. A comparison of eelgrass, sea lettuce
macroalgae, and marsh creeks as habitats for epibenthic fishes and deca-

s. Es 19.

Tuayer, G. W., W. J. KENworTHY, AND M. S. Fonseca. 1984. The ecology
of eelgrass meadows of the Atlantic coast: A community profile. USFWS
FWS/OBS-84/02.

MurPHEY, AND M. W. LACrorx. 1994. Responses of plant com-
nuunities in western Florida Bay to the die-off of seagrasses. Bull. Mar.
Sci. 54: 718-726.

ZIEMAN, J. C., R. DAvIs, J. W. FOURQUREAN, AND M. B. RosBLEE. 1994. The

role of climate in the Florida Bay seagrass dieoff. Bull. Mar. Sci. 54:
1088

RHODORA, Vol. 101, No. 905, pp. 46-86, 1999

THE DISTRIBUTION OF THE BRYOPHYTES AND
VASCULAR PLANTS WITHIN LITTLE DOLLAR LAKE
PEATLAND, MACKINAC COUNTY, MICHIGAN

C. Eric HELLQUIST! AND GARRETT E. CROW
Department of Plant Biology,
University of New Hampshire, Durham, NH 03824
‘ Current Address: 391 West Road, Adams, MA 01220

ABSTRACT. Little Dollar Lake peatland, a Sphagnum-dominated poor fen
peatland complex, has a flora consisting of 36 bryophyte and 93 vascular
plant species. Random, quantitative sampling of 279 one-meter-square quad-
rats along 13 transects on six Lars and mats was analyzed by two-way indi-
cator species analysis (TWINSPAN). Based on interpretation of the TWIN-
SPAN analysis, three vegetation cover types and six constituent vegetation
phases were delineated. The three cover types were designated as the Cala-
magrostis canadensis cover type (lagg habitats), the Chamaedaphne calycu-
lata cover type (peatland mat habitats), and the Chamaedaphne calyculata—
Triadenum fraseri cover type (transitional habitats with evidence of terres-
trialization). A fourth association, the Potamogeton confervoides—Utricularia
Scop cover type, was recognized based on qualitative field observa-

pera evidence suggests that terrestrialization and small-scale paludification
are occuring in some areas of the peatland.

Key Words: peatland, bog, fen, Sphagnum, bryophytes, vascular plants, ter-
restrialization, TWINSPAN, Michigan

Peatlands are wetlands especially characteristic of northern re-
gions across North America and Eurasia that form in cool, tem-
perate or maritime climates where evapotranspiration is low. Peat
deposits dominate the boreal environments of Canada (170 x 10°
ha), the former Soviet Union (150 X 10° ha), and the United
States (36.8 X 10° ha; Gorham 1990). Near the southern edge of
the glacial boundary in North America, peatlands tend to be more
sporadic and are usually confined to smaller areas (typically gla-
cial scour basins or kettleholes), as opposed to the extensive mires
that blanket the landscape of subarctic latitudes (Crum 1988).
Along the glacial boundary, peatland basins are frequently frost
pockets that serve as refugia for northern plants at the southern
edge of their ranges (e.g. Andreas and Bryan 1990; Crum 1988;
Damman and French 1987; Pielou 1979).

The peat of boreal regions consists of partially decomposed

1999] Hellquist and Crow—Little Dollar Lake Peatland 47

remains of bryophytes (especially Sphagnum) and vascular plants
(primarily sedges and ericaceous shrubs), as well as minute
amounts of inorganic matter (Crum 1988; Damman and French
1987; Moore and Bellamy 1974). Although the majority of wet-
lands produce peat to some extent, northern peatlands store vast
quantities of peat because rates of organic deposition greatly ex-
ceed rates of decomposition (Crum 1988).

Peatlands are typically associated with acidic water chemistry.
The main causes of peatland acidity are the result of a variety of
biogeochemical processes and positive feedbacks (Crum 1988;
Gorham 1957; van Breeman 1995) involving the presence of or-
ganic acids within the anoxic subsurface peat (Hemond 1980;
Kilham 1982), the high cation exchange capabilities of Sphagnum
taxa (Andrus 1986; Clymo 1963, 1964; Crum 1988; Kilham
1982; Spearing 1972; Vitt et al. 1975), the uptake of ions by
vegetation (Kilham 1982), the overall hydrological characteristics
of individual peatland systems (Kilham 1982; Vitt et al. 1975),
the oxidation of reduced sulfur Seaside (Clymo 1964; Gor-
ham 1961), and, occasionally, acid precipitation (Clymo 1964;
Crum 1988).

Conditions within peatlands are generally considered less than
optimal for vascular plant growth and establishment (Clymo and
Hayward 1982; Moore and Bellamy 1974; van Breeman 1995;
Vitt et al. 1995). However, extensive bryophyte communities
thrive in peatland environments of boreal landscapes (Vitt 1990).
Due to their intimate contact with the aqueous chemical environ-
ment of the peatland, bryophytes are strong indicators of micro-
habitat conditions (Vitt and Slack 1984). Peatland vegetation dis-
pean itself based largely on gradients of minerotrophy (e.g.

kalinity) and pH, as well as light and hydric conditions of mi-
crohabitats (e.g. Anderson and Davis 1997; Gignac and Vitt 1994;
Jeglum 1971; Vitt and Chee 1990; Vitt and Slack 1975; Wheeler
et al. 1983).

Peatlands exhibit strong floristic similarities across much of
North America, resulting in similar species composition patterns
in regions such as the Northeast and upper Midwest of North
America (Crum 1988; Gore 1983; Wheeler et al. 1983). From site
to site, the diversity of both bryophyte and vascular peatland flo-
ras is highly influenced by the microhabitat heterogeneity of the
peatland. The greater the diversity of microhabitats available, the

48 Rhodora [Vol. 101

greater the species richness of the peatland (Anderson and Davis
1997; Vitt et al. 1995)

An extensive and often confounding literature exists regarding
the classification of peatland systems. Researchers classify peat-
lands utilizing a variety of terms and definitions that assess peat-
land attributes ranging from edaphic and physical characteristics
to vegetation community composition (Gore 1983). Based on wa-
ter chemistry, peatlands can be classified generally into two polar
groups, Oombrotrophic peatlands (bogs) and minerotrophic peat-
lands (fens). A third group, oligotrophic peatlands, have inter-
mediate water chemistry and floristic characteristics.

Ombrotrophic peatlands receive all mineral subsidies from at-
mospheric deposition or from nutrients released during the slow
decay of organic matter within the peatland basin. Thus, these
peatlands are extremely nutrient-limited (Crum 1988; Damman
and French 1987; Gore 1983). Ombrotrophic peatlands may be
cut off from drainage or flushing by their geomorphological ori-
entation, such as in a kettlehole bog. These peatlands may also
be isolated from the water table by their own prolific deposition
of peat that can elevate the peatland above the influence of
groundwater, such as in a maritime raised bog (Crum 1988; Dam-
man and French 1987). Due to the lack of active water circula-
tion, hydrogen ions accumulate in ombrotrophic peatlands often
resulting in pH values of 4.01—4.25 in the narrow definition of
Gorham and Janssens (1992a), or less than 5.0 in the broader
definition of Vitt et al. (1995). Bryophyte communities in om-
brotrophic and oligotrophic peatlands are extensive and are dom-
inated by Sphagnum species (Crum 1988; Gorham and Janssens
1992a; Janssens and Glaser 1986; Schwintzer 1981; Vitt 1990,
Vitt and Slack 1975, 1984; Vitt et al. 1995)

Minerotrophic peatlands (fens) are relatively nutrient-rich com-
pared to their ombrotrophic counterparts. Fens receive mineral
subsidies from rheotrophic (flowing) ground or surface sources,
as well as from precipitation. The nutritive input of a fen is
unique from site to site based on the physical orientation and
hydrology of the peatland. Thus, the mineral concentrations of
fens are tremendously variable (Damman and French 1987; Gig-
nac and Vitt 1994; Gore 1983). Edaphic inputs enrich fen en
with higher concentrations of calcium, iron, magnesium, alumi
num, and phosphorus ions and higher relative pH levels ons)
ombrotrophic peatlands (Gignac and Vitt 1994; Gorham 1990;

1999] Hellquist and Crow—Little Dollar Lake Peatland 49

Jeglum 1971; Schwintzer 1978; van Breeman 1995). Fens are
often subclassified as poor fens (pH 4—6) to extreme rich fens
(pH 6—7.5) based on the relative minerotrophy, pH values, and
plant species composition (pH values for the upper Midwest from
Crum

The relative minerotrophy and higher pH levels of fens are
reflected in their floras which become more species-rich along a
gradient from low to high nutrient availability, i.e., oligotrophic
to minerotrophic conditions (Crum 1988; Damman and French
1987; Glaser 1987; Gorham 1990; Schwintzer 1981). Fens typi-
cally have an extensive sedge cover that is often dominated by
Carex lasiocarpa Ehrh., a less prominent bryophyte cover, and
greater overall species richness compared to ombrotrophic peat-
lands (Crum 1988; Glaser 1987; Schwintzer 1978; Vitt et al.
1995)

Bryophytes in fens tend to be dominated by members of the
Amblystegiaceae, including Amblystegium spp., Calliergon spp.,
and Scorpidium scorpioides (Hedw.) Limpr. (Gorham and Jan
sens 1992a; Janssens and Glaser 1986; Vitt 1990; Vitt et ]
1995). Sphagnum taxa have reduced frequencies in fen ecosys-
tems, but are nevertheless present. Species such as Sphagnum
teres (Schimp.) Angstr. ex C. Hartm. and Sphagnum subsecundum
Nees ex Sturm are typically prominent in alkaline fen conditions,
particularly on the edge of the mat along open water (Crum
1988).

Most basin peatlands containing ponds or lakes exhibit the
classic zonation of vegetation communities where a floating com-
munity of sedges, Sphagnum, and/or ericaceous shrubs encroach
over the open water of a lake (e.g., Crow 1969; Dunlop 1987;
Fahey 1993; Fahey and Crow 1995; Schwintzer and Williams
1974). The more or less concentric vegetation patterns of peat-
lands that radiate outward from lake margins led early ecologists
to propose the “‘hydrosere model” of peatland succession.
hydrosere model states that lake margin communities fill in or
terrestrialize the open water of a pond or lake, and initiate a
successional sequence that passes through ericaceous shrub as-
sociations, coniferous forest associations, and finally culminates
in an upland forest climax community on what was formerly the
peatland (e.g., Dansereau and Segadas-Vianna 1952; Gates 1942;
Transeau 1903).

Recently, this traditional hydrosere explanation that links spa-

50 Rhodora [Vol. 101

tial zonation with successional processes has been called into
question by peatland ecologists (Klinger 1996; van Breeman
1995). Although the process of terrestrialization in basin peat-
lands has been well documented, Klinger (1996) has reservations
regarding two major tenets of the hydrosere model. First, it is
unlikely that a mesic forest “‘climax”’ is the ultimate successional
destiny of a peatland basin. Second, terrestrialization of peatlands
is not necessarily a unidirectional process; instead it is quite often
a dynamic progression of vegetation advance and recession along
a water body (e.g. Schwintzer and Williams 1974).

Citing a lack of data from stratigraphic, dendrochronological,
and vegetational analyses to support strict hydrosere peatland suc-
cession, “the bog climax model” of peatland succession has been
proposed (Klinger 1996). This model states that peatland condi-
tions are their own climax in middle to high latitudes. In this
model, peatland mats extend outward from lake margins via ter-
restrialization, while Sphagnum mosses along the outer edge of
the peatland expand beyond the limits of the basin and into the
upland via paludification. Therefore, in the absence of large scale
disturbances and alterations of peatland hydrology, peatland sys-
tems remain ecologically intact for thousands of years (Klinger
1996). Early in peatland succession allogenic factors are impor-
tant, but they later become secondary to autogenic factors that
are initiated and maintained by the flora itself (Klinger 1996).

This paper outlines the vegetation associations found within
Little Dollar Lake peatland based on field observations and
TWINSPAN analysis. Comparisons of vegetation patterns at Lit-
tle Dollar Lake peatland to other North American peatlands in
the upper Midwest, Canada, and the Northeast are emphasized.
The role of terrestrialization and paludification in peatland suc-
cession is also discussed with reference to vegetation patterns
observed at Little Dollar Lake peatland.

SITE DESCRIPTION

The Little Dollar Lake peatland basin is 14 hectares (34 acres)
in area. The peatand is located in west-central Mackinac County
on the eastern Upper Peninsula of Michigan (T44N, R8W, NE1/
4 Sec. 28, Hudson Township). Little Dollar Lake has acidic water
chemistry (mean pH = 4.5, n = 40) and is situated in a shallow
glacial scour basin. Based on pollen stratigraphy and sedimenta-

1999] Hellquist and Crow—Little Dollar Lake Peatland 51

Outlet

Northwestern Mat

ey,
Little Dollar Lake

Western Mat

Southern Mat

Southwestern Mat Extension

40m

Figure 1. Map of Little Dollar Lake peatland illustrating transect loca-
tions and selected features of local geography around and within the peatland

Upland islands on southwestern mat; 3. Upland peninsula; 4. Muck pools in
the southern mat extension; 5. Stream channel; 6. Location of the transect on
the eastern mat parallel to the upland.

tion, the peatland around Little Dollar Lake began to form a
proximately 3500 years before present as a result of prolonged
increases in the regional water tables of eastern upper Michigan
(Futyma 1982). Basin morphology, post-glacial history, soils, sur-
rounding upland vegetation, and climate are described by Hell-
quist (1996) and Hellquist and Crow (1997).

Little Dollar Lake is surrounded by seven peatland mats of
varying extent. These mats were named based on their compass-
point position around Little Dollar Lake (Figure 1). Each mat is
colonized by a variety of plant associations. In general, the peat-

52 Rhodora [Vol. 101

land is characterized by a nearly continuous layer of Sphagnum
spp. covered by expanses of open ericaceous scrub. A narrow,
floating mat fringes much of the lakeshore and a graminoid lagg
borders the upland of several mats.

MATERIALS AND METHODS

Bryophyte and vascular vegetation sampling. Vegetation
analysis and mapping were conducted using transect sampling
procedures. Thirteen transects, intersecting as many plant com-
munities as possible, were surveyed and divided into ten-meter
intervals. Using a table of pseudo-random numbers, two one-
meter-square (1 m X 1 m) quadrats were chosen for sampling
within each ten-meter interval. In some spatially narrow habitats,
extra quadrats were added to help insure adequate sampling. From
July 12, 1995 through August 15, 1995, 279 one-meter-square
quadrats were sampled visually for frequency and absolute per-
cent cover of bryophyte and vascular species. Cover was defined

s ““... an estimate of the area of coverage of the foliage of the
species in a vertical projection on to the ground” (Shimwell 1971,
p. 110). Species composition and absolute percent cover were
estimated separately for the bryophyte and vascular strata in each
quadrat.

SPAN vegetation analysis. Bryophyte and vascular
percent cover data from the 279 sampled quadrats were analyzed
using two-way indicator species analysis (TWINSPAN; Hill
1979). TWINSPAN is a polythetic divisive procedure that uses
reciprocal averaging to ordinate quadrats, ultimately creating an
ordered site-by-species two-way table (Hill 1979). Seven pseu-
dospecies cut levels (Hill 1979: van Tongeraan 1987) were es-
tablished as follows: 1 (0O-1% cover), 2 (1-2% cover), 3 (2-5%
cover), 4 (5S—10% cover), 5 (10-25% cover), 6 (25-50% cover),
and 7 (50—100% cover). All cut levels were weighted equally.

For studies involving the classification of ecological commu-
nities, there are several advantages to employing TWINSPAN
analysis. These include its use of raw data, its hierarchical clas-
sification of both plots and species, and the ability to rewrite the
arranged data matrix in a dendrogram format that enhances the
clarity of plot relationships (Gauch 1982). TWINSPAN analysis
has been utilized in many investigations of peatland vegetation

1999] Hellquist and Crow—Little Dollar Lake Peatland 33

Table 1. Species richness of the four vegetation cover types (CT) and six
cover phases (PHS). The number of quadrats in each cover type or phase is
noted in parentheses

Species

TWINSPAN Community Delineation Richness
Potamogeton confervoides—Utricularia geminiscapa CT 7
Calamagrostis canadensis CT (27) 54
Iris versicolor—Lycopus uniflorus PHS (13) 44
Sphagnum cuspidatum—Dulichium arundinaceum PHS (14) 30
Chamaedaphne calyculata CT (220 56
Sphagnum recurvum—Carex oligosperma PHS (186) 53
Sphagnum magellanicum—Sarracenia purpurea PHS (34) 27
Chamaedaphne calyculata—Triadenum fraseri CT (32) ST
Sphagnum majus PHS (22) 26
Sphagnum papillosum PHS (10) a

(Anderson and Davis 1997; Dunlop 1987; Fahey and Crow 1995;
Miller 1996; Slack et al. 1980; Vitt and Chee 1990; Vitt et al.
1990)

RESULTS

TWINSPAN classification. Field observations and data
weighed in concert with TWINSPAN analysis resulted in the de-
lineation of four distinct vegetation cover types (including the
aquatic vegetation of the lake) and six constituent vegetation
phases within the Little Dollar Lake basin (Table 1; Figures 2
and 3). The aquatic cover type was recognized based on field
pee Although these cover types were delineated pri-
ough TWINSPAN analysis, only plant communities that
could fe eed clearly in the field have been recognized. The
complete TWINSPAN two-way table and raw data are available
in Hellquist (1996).
Those species that were prominent both in the field and in the
SPAN analysis were chosen as appropriate species to name
the cover types (CT) and phases (PHS). Due to overlap of indi-
cator species between clusters, or to the relatively inconspicuous
nature of the TWINSPAN indicator species in the soli tend
of a cover type or phase, the TWINSPAN indicator species w
not always adopted as appropriate “representative species’ core
the names of cover types and phases. Indicator species for the
cover types and phases are noted in Tables 2-10. Although sim-

279
252 27
CALAMAGROSTIS CANADENSIS
220 32 13 14
CHAMAEDAPHNE CALYCULATA CHAMAEDAPHNE CALYCULATA- Iris versicolor- Sphagnum cuspidatum-
TRIADENUM FRASERI Lycopus uniflorus Dulichium arundinaceum
107 ii3 22 10
Sphagnum majus Sphagnum papillosum
34 73
Sphagnum magellanicum- Sphagnum recu
Sarracenia purpurea Carex pr case

Figure 2. Dendrogram of the vegetation cover types and phases as delineated by TWINSPAN and field observation. Designations
in all capital lettering are cover types, designations with capital and lowercase lettering are phases. Numbers refer t
of quadrats in each cover type or phase. The arrow indicates that the clusters of 113 and 73 plots were combined to form the
Sphagnum recurvum—Carex oligosperma phase

eviopoyuy

TOT TOA]

1999] Hellquist and Crow—Little Dollar Lake Peatland 55
CALAMAGROSTIS CANADENSIS COVER TYPE
Iris versicolor-Lycopus uniflorus Phase

q Sphagnum cuspidatum-Dulichium arundinaceum Phase

CHAMAEDAPHNE CALYCULATA COVER TYPE
Sphagnum recurvum-Carex oligosperma Phase
Sphagnum magellanicum-Sarracenia purpurea Phase
CHAMAEDAPHNE CALYCULATA-TRIADENUM FRASERI COVER TYPE

wa Sphagnum majus Phase

(SS .
?

Figure 3. Vegetation map of Little Dollar Lake peatland illustrating the
extent of the vegetation cover types and constituent vegetation hases. le
Sphagnum papillosum phase is not mapped due to its narrow spatial distri-
bution. This phase is present in a narrow (~ 1.0 m) band along the lake margin
in all areas where the Sphagnum magellanicum—Sarracenia purpurea phase

is present. Scale is approximate.

56 Rhodora [Vol. 101

ilarities to other peatland complexes in the upper Midwest do
exist, the names of these communities are not intended to have
regional applicability due to the inherent variability of hydrology
and topography that directly influences the composition of indi-
vidual peatland floras.

INSPAN classification split the initial set of 279 quadrats
into two groups, a group of 252 quadrats and a second group of
27 quadrats (Figure 2). The 27 quadrats were designated as the
Calamagrostis canadensis CT. At the second level the C. cana-
densis CT was divided further into phases of 13 and 14 quadrats
respectively. The cluster of 13 quadrats was named the Iris ver-
sicolor—Lycopus uniflorus PHS, and the cluster of 14 quadrats
was named the Sphagnum cuspidatum—Dulichium arundinaceum
PHS (Figure 2).

The remaining 252 quadrats were split into two clusters, one
cluster of 220 quadrats and one cluster of 32 quadrats. The cluster
of 220 quadrats was named the Chamaedaphne calyculata CT or
“ericaceous scrub,” and the cluster of 32 quadrats was named
the C. calyculata-Triadenum fraseri CT (Figure 2). The two
phases of the C. calyculata CT consisted of clusters of 186 quad-
rats and 34 quadrats.

TWINSPAN separated the 220 quadrats of the Chamaedaphne
calyculata CT into clusters of 107 and 113 quadrats (Figure 2).
The cluster of 113 quadrats at the third level had an essentially

bined into a cluster of 186 quadrats (Figure 2). These 186 quad-
rats were representative of the Sphagnum recurvum—Carex oli-
gosperma PHS (hummock-hollow complex) of the C. calyculata
By

The remaining 34 quadrats, isolated from TWINSPAN’s cluster
of 107 quadrats at the fourth level, had a unique suite of species
that corresponded to the floating-mat community along the north-
ern and southern lake margin. This cluster was named the Sphag-
num magellanicum—Sarracenia purpurea PHS of the Chamae-
daphne calyculata CT (Figure 2).

Lastly, at the second cut level, the cluster of 32 quadrats that
composed the Chamaedaphne calyculata-Triadenum Sraseri CT
was divided into two constituent phases (Figure 2). The Sphag-

1999] Hellquist and Crow—Little Dollar Lake Peatland 57

num majus PHS consisted of 22 quadrats and was associated with
the stream channel and the narrow eastern and western mats (Fig-
ures 1 and 3). The remaining ten quadrats, the Sphagnum papil-
losum PHS, formed an approximately two to three meter zone
immediately bordering the open water of the majority of the peat-
land.

Species richness and frequency within sampling quad-
rats. The Calamagrostis canadensis CT and the Chamaeda-
phne calyculata CT were the most species rich of the cover types
(Table 1). The C. canadensis CT was restricted to more miner-
otrophic lagg areas. Despite being sampled by only 27 quadrats,
this cover type contained 54 species. The C. calyculata CT was
slightly more diverse, but was sampled extensively by 220 quad-
rats. The most diverse phase was the Sphagnum recurvum—Carex
oligosperma PHS of the C. calyculata CT (Table 1). The next
most diverse phase was the Jris versicolor—Lycopus uniflorus ae
of the C. canadensis CT (Table 1). The 7. versicolor—L. unifloru
PHS consisted of only 13 quadrats but contained 44 different
species. The most species-poor cover type or phase was the Po-
tamogeton confervoides—Utricularia geminiscapa CT. With only
seven species, this cover type was restricted to the open water of
Little Dollar Lake.

The nutrient-poor nature of the peatland was emphasized by
the dominance of the Sphagnaceae (peat moss family) and the
Ericaceae (heath family) on a visual and a quantitative level with-
in the 279 sampling quadrats. Of the ten most frequent species
in the 279 quadrats, eight belonged to either the Sphagnaceae or
the Ericaceae (Figure 4). Of these ten species, Chamaedaphne
calyculata (L.) Moench was the most abundant species, occurring
in 258 quadrats (92%). Vaccinium oxycoccos L. was second, oc-
curring in 218 quadrats (78%). The most abundant sedge was
Carex oligosperma Michx. which was present in 106 quadrats
(38%).

The tenth most frequent taxon in the 279 quadrats was Acer
rubrum L. This species was present only as seedlings or small
saplings in the quadrats sampled. Seedlings were noted in 23%
of the quadrats sampled. In every quadrat in which A. rubrum
appeared, it had a cover value of less than 2%. Of the ten most
abundant species, the only bryophytes were members of the
Sphagnaceae (Figure 4

58 Rhodora [Vol. 101

Percent frequency from 279 quadrats
wa
i)
|

» ° rs se ew aw
Ny P 40 a0 < x y) “
i se Fol a ss Ao ox &

we
ro
4

6
*
g Vv e<
x e e RS
9

Figure 4. Percent frequency of the ten most abundant species in the 279
quadrats sampled. The number above each bar equals the total number of
quadrats in which each species occurred.

DISCUSSION

The vegetation of Little Dollar Lake peatland. The bryo-
phyte flora of Little Dollar Lake peatland consisted of 36 species
including eleven species of Sphagnum. The vascular flora of the
peatland was comprised of 93 species dominated by sedge species
(Cyperaceae) and heath species (Ericaceae). The complete bryo-
phyte and vascular flora of Little Dollar Lake peatland, including
comments on abundance and habitats, is presented in Hellquist
and Crow (1997).

1999] Hellquist and Crow—Little Dollar Lake Peatland 59

The following discussion summarizes the vegetation patterns
at Little Dollar Lake peatland, and emphasizes the presence of
various plant species as a means to infer the nutrient status of a
peatland or microhabitats within a peatland. The four cover types
and the six constituent phases are discussed in a roughly centrip-
etal manner starting with the lagg communities on the outside of
the peatland basin and proceeding inward toward Little Dollar
Lake.

1. Calamagrostis canadensis Cover Type

The outermost portion of a basin peatland is known as the lagg
or moat. The lagg is an ecotone (sensu Risser 1995) between the
consolidated peat of the open mat and the mineral soils of the
upland. The lagg is characterized by shallower, better aerated peat
that is enriched by nutrients from the adjacent upland (Crum
1988; Damman and French 1987; Gore 1983). A moat of open
water separating the upland from the peatland proper is often
found within the lagg area. The lagg is typically one of the most
botanically diverse communities within a peatland. The lagg usu-
ally contains minerotrophic wetland species that are not exclu-
sively associated with peatland floras except in the context of lagg
habitats (Crum 1988). Thus, the species composition of the lagg
reflects a more minerotrophic or marsh-like physiognomy com-
pared to the majority of the peatland basin.

The Calamagrostis canadensis CT formed an encircling, fen-
like community adjacent to the upland on all peatland mats of
the basin except the narrow eastern and western mats (Figure 3).
In northern Michigan, a C. canadensis (Michx.) P. Beauv. asso-
ciation typically follows fire and sometimes develops in the mar-
ginal areas of peatlands that are damp, but not extremely wet
(Gates 1942). In the summers of 1994 and 1995, this cover type
was merely damp with no standing water. In 1996, however, most
of this cover type was saturated with water or had standing water
0.25 to 0.50 m in depth, especially in areas of the southwestern
mat and southern mat extension.

Sphagnum species were not as prominent in the oeyiene
canadensis CT, with only S. recurvum P. Beauv. and S.
datum Hoffm. occurring with some frequency (Table 2). ied
num recurvum was apparent in the open, outer areas of lagg closer
to the ericaceous scrub, while S. cuspidatum formed lush pockets
in the wettest, muckiest areas of the lagg. In 1996, S. cuspidatum

60 Rhodora [Vol. 101

Table 2. Mean percent cover and percent frequency of dominant and as-
sociated species in the Calamagrostis canadensis cover type consisting of 27
quadrats out of 279. Species having less than 10% frequency are not included

in the tabl ‘AN indicator species. Lycopus uniflorus was also des-
ignated as an indicator species, but does not appear in the table.
Mean % Cover % Frequency
BRYOPHYTES
Sphagnum recurvum 55 a1L9
Sphagnum cuspidatum* 27 30.0
Warnstorfia fluitans 5 14.8
Calliergon cordifolium 27 fT
Calliergon stramineum 22 ia
Callicladium haldanianum 4 li
VASCULAR PLANTS
Calamagrostis canadensis* 30 88.9
Carex lasiocarpa 38 74.1
Potentilla palustris 5 55.6
Triadenum fraseri 2 dit
Chamaedaphne calyculata 18 37.0
Acer rubrum <l 37.0
Lysimachia thyrsiflora 2 30.0
Iris versicolor* 14 26.0
Glyceria canadensis 26 13.5
Lysimachia terrestris 2 18.5
Galium trifidum A 15.0
Dulichium arundinaceum 20 14.8
Impatiens capensis 8 14.8
ospe 10 11.)
Scutellaria galericulata 5 Ll
Equisetum fluviatile 2 EEA

flourished in the standing water of southern lagg areas with del-
icate individuals growing to lengths as long as 0.25 m. While
there was a lack of Sphagnum diversity in this cover type, mem-
bers of the Amblystegiaceae contributed to the diverse bryophyte
flora of this cover type. Members of this minerotrophic-indicative
family, Calliergon cordifolium (Hedw.) Kindb. and C. strami-
neum (Brid.) Kindb., often were observed thriving in wet, decom-
posing leaf litter.

The two most frequent and dominant vascular species were
Calamagrostis canadensis and Carex lasiocarpa (Table 2). These
two species grew intermingled and gave the lagg community its
narrow-leaved graminoid texture that was readily distinguished

1999] Hellquist and Crow—Little Dollar Lake Peatland 61

from the neighboring ericaceous scrub community. At the height
of the growing season, the prominence of C. canadensis gave the
lagg a distinct marsh-like appearance. Other widely scattered, but
locally abundant species of this community type included Galium
tinctorium L., Iris versicolor L., Lysimachia thyrsiflora L., L. ter-
restris (L.) B.S.P., Lycopus uniflorus Michx., and Potentilla pal-
ustris (L.) Scop.

The species within the graminoid lagg at Little Dollar Lake
peatland were similar to the herbaceous component of the lagg
at Mud Pond Bog (Moultonborough, NH). Species found in both
of these peatlands included Calamagrostis canadensis, Lycopus
uniflorus, Scirpus cyperinus (L.) Kunth, and Scutellaria galeri-
culata L. (C. E. Hellquist, ms. in prep.). The lagg communities
at Mud Pond Bog were also characterized by an extensive tall
shrub lagg association dominated by J//ex verticillata (L.) A. Gray,
Nemopanthus mucronatus (L.) Trel., Lyonia ligustrina (L.) DC.,
Vaccinium corymbosum L., and Viburnum nudum L. (C. E. Hell-
quist, ms. in prep.). At Little Dollar Lake, typical lagg shrubs
such as /. verticillata and N. mucronatus grew infrequently within
the peatland basin itself, although both taxa grew abundantly in
rich upland soils that immediately fringed the lagg. The presence
of I. verticillata, N. mucronatus, and V. nudum vat. cassinoides
(L.) T. & G. at Little Dollar Lake is reminiscent of the /. verti-
cillata-N. mucronatus community type described for northern
Michigan kettlehole peatlands (Vitt and Slack 1975). This cover
— also resembled the I. verticillata-Acer—Carex canescens
co t found nearest the upland in Mud Pond Bog
(Hillsborough. NH; Dunlop 1987). Species common to these cov-
er types include J. verticillata, Acer rubrum, Lysimachia terres-
tris, Lycopus uniflorus, and C. canadensis (Dunlop 1987).

1A. Iris versicolor-Lycopus uniflorus Phase

The substrate of the /ris versicolor-Lycopus uniflorus PHS
(Figure 3) was composed of very shallow peat (<1.0 m) that
often was covered by decaying leaf duff from upland trees. The
presence of shade-tolerant Sphagnum squarrosum Crome empha-
sized the nutrient-rich nature of the lagg habitat. Sphagnum
squarrosum typically grows in minerotrophic, alkaline Thuja oc-
cidentalis L. swamps and swampy woodlands (Andrus 1980;
Crum 1983, 1988). The most abundant non-Sphagnum bryophyte
was Calliergon cordifolium, a species that thrived in damp leaf

62 Rhodora [Vol. 101

Table 3. Mean percent cover and percent frequency of dominant and as-
sociated species in the Iris versicolor-Lycopus uniflorus phase of the Cala-
magrostis canadensis cover type (13 quadrats). Species having less than 10%
frequency are not included in the table. *TWINSPAN indicator species.

Mean % Cover % Frequency

BRYOPHYTES
Sphagnum recurvum 60 84.6
Warnstorfia fluitans a 15.4
Calliergon cordifolium* 27 23-1
Callicladium haldanianum 4+ 235.1
Drepanocladus uncinatus 6 15.4
Dicranum flagellare fi 15.4
Pleurozium schreberi 8 15.4

VASCULAR PLANTS
Calamagrostis canadensis 44 100.0
Carex lasiocarpa 31 G9:2
Potentilla palustris o 61.5
Lycopus uniflorus ey 61.5

—
ge
i
38
g.
g 2
is)
3 >
_
A ms
—
Ann
Wd Wo
oo oO

Triadenum fraseri 3

Lysimachia terrestris 2 38.5
Impatiens capensis 8 30.8
Galium trifidum 3 30.8
Chamaedaphne calyculata 6 231
Scutellaria galericulata 5 23.1
Carex canescens 8 15.4
Carex oligos, 13 15.4
Viola macloskeyi 6 15.4

well as the mosses Climacium dendroides (Hedw.) Web. & Mohr.

peatlands may have a fringing Jris association less than a meter
wide (Gates 1942). At Little Dollar Lake, I. versicolor was a

1999] Hellquist and Crow—Little Dollar Lake Peatland 63

prominent component of the C. canadensis CT with a distribution
several meters in width, especially in the lagg areas of the south-
ern-oriented peatland mats.

Within the Jris versicolor—Lycopus uniflorus PHS there was
one locality that had an entirely unique species composition com-
pared to the rest of the peatland. This area was situated within
the peNe i of the southwestern mat (Figure 1) in an area that ap-

ently was influenced by runoff from a seasonal, dirt truck trail
(Heliquist 1996). In this area, Typha latifolia L. was well estab-
lished. Futyma (1982) noted the presence of Typha in the basin
in the early 1980s, but made no reference to the location of the
colony. Other species essentially limited to this distinct lagg hab-
itat were Carex stipata Muhl., Epilobium ciliatum Raf., Polygo-
num cilinode Michx., Rubus canadensis L., Scutellaria laterifiora
L., and Rumex obtusifolius L.

1B. Sphagnum cuspidatum—Dulichium arundinaceum Phase

The Sphagnum cuspidatum—Dulichium arundinaceum PHS oc-
curred in two distinct areas in the southeastern and western lagg
areas of the southern mat extension (Figure 3). This association
was apparent in the wettest areas of lagg that contained exposed,
mucky peat. In 1996, this area was covered by standing water
roughly 0.25 to 0.50 m deep. The most frequent vascular species
of this phase included Calamagrostis canadensis, Carex ad
carpa, Chamaedaphne calyculata, and Potentilla palustris. Thirtee
species with greater than 10% frequency were present Sona
Glyceria canadensis (Michx.) Trin., Carex utriculata F Boott,
Equisetum fluviatile L., and Salix pedicellaris Pursh (Table 4).

aie dominant peat mosses of this phase were Sphagnum re-
curvum and S. cuspidatum (Table 4). Other important bryophyte
species included members of the Amblystegiaceae such as Warns-
torfia fluitans, W. exannulata (Schimp. in B. S.G.) Loeske [Dre-
panocladus exannulatus (Schimp. in B.S.G.) Warnst.], Calliergon
cordifolium, and C. stramineum. Despite its infrequency in the
quantitative sampling of this phase, W. exannulata formed an
almost homogeneous bryophyte cover on exposed, mucky peat
in the southeastern lagg of the southern mat extension. In 1996,
this same population of W. exannulata was still vigorous despite
being submerged in standing water. Warnstorfia exannulata is
considered a dominant species of poor fens in Alberta along with
Sphagnum angustifolium (C. Jens. ex Russ.) C. Jens., S. majus

64 Rhodora [Vol. 101

Table 4. Mean percent cover and percent frequency of dominant and as-
sociated species in the Sphagnum cuspidatum—Dulichium arundinaceum
phase of the Calamagrostis canadensis cover type (14 quadrats). Species
having less than 10% frequency are not inched in age table. *TWINSPAN
indicator species.

Mean % Cover % Frequency
BRYOPHYTES
Sphagnum recurvum 38 21.4
Sphagnum cuspidatum* 27 S71
Warnstorfia fluitans 8 14.3
Sphagnum maju | 14.3
Calliergon stramineum 30 14.3
Calliergon cordifolium 27 jf By |
VASCULAR PLANTS
Calamagrostis canadensis* 14 78.6
Carex lasiocarpa* 43 78.6
Chamaedaphne calyculata 24 50.0
Potentilla palustris S, 50.0
Lysimachia thyrsiflora* 1 me |
Triadenum fraseri <1 35:1
Glyceria canade 32 28.6
Dulichium arundinaceum* 20 28.6
Acer rubrum ca | 21.4
Carex utriculata 8 14.3
Vaccinium macrocarpon 3 14.3
Equisetum fluviatile 2 14.3
Salix pedicellaris 23 14.3

(Russ.) C. Jens., and S. jensenii H. Lindb. (Vitt and Chee 1990).
Although members of the Amblystegiaceae tend to prefer more
minerotrophic microhabitats, W. fluitans and C. stramineum seem
to occur in acid to intermediate acid habitats (ca. pH 3.7-6.0;
Gorham and Janssens 1992b).

At Little Dollar Lake, several emergent vascular species col-
onized this rich muck including Carex lasiocarpa, Dulichium
arundinaceum (L.) Britton, Glyceria borealis (Nash) Batchelder,
Juncus alpinus Vill., Potentilla palustris, and Puccinellia pallida
(Torr.) R. T. Clausen. The only locality of Carex chordorrhiza L.
f. was in the exposed peat of the southeastern lagg. Carex chor-
dorrhiza is considered a species indicative of poor fens in Min-
nesota (Wheeler et al. 1983) and rich fen conditions in Alberta
(Vitt and Chee 1990).

1999] Hellquist and Crow—Little Dollar Lake Peatland 65

Table 5. Mean percent cover and percent frequency of dominant and as-
sociated species in the Chamaedaphne calyculata cover type (220 quadrats).
Species having less than 10% frequency are not included in the table.

*TWINSPAN indicator species.

Mean % Cover % Frequency
BRYOPHYTES
Sphagnum recurvum 74 83.2
Sphagnum majus 50 36.3
Sphagnum magellanicum* 14 26.5
Aulocomnium palustre 6 1S
Sphagnum capillifolium* 18 10.6
VASCULAR SPECIES
Chamaedaphne calyculata 46 99.1
Carex oligospe 26 94.7
Kalmia polifoli 15 62.8
Andromeda glaucophylla 11 36.3
cer rubrum <l 27.4
Vaccinium oxycoccos* 7 14.2

2. Chamaedaphne calyculata Cover Type

The maedaphne _ calyculata CT was unquestionably the
most prominent cover type within the peatland (Figure 3). Mem-
bers of the Ericaceae lent this cover type its scrubby, homoge-
neous appearance. These shrubs occurred more or less continu-
ously across a mosaic of hummocks and hollows carpeted by
several species of Sphagnum. The Sphagnum recurvum—Carex
oligosperma PHS was characterized by the grounded hummock-
hollow complex. The Sphagnum magellanicum—Sarracenia pur-
purea PHS formed narrow bands of quaking mat that fringed the
majority of the lake (Figure 3).

The three dominant ericaceous shrubs of this cover type were
Chamaedaphne calyculata, Kalmia polifolia Wangenh., and An-
dromeda glaucophylla Link (Table 5). The prostrate ericad Vac-
cinium oxycoccos was also apparent in this community, with in-
dividuals winding over Sphagnum and between branches of eri-
caceous shrubs on relatively open hummocks. Carex si

a, the most ubiquitous sedge of the peatland, was
characteristic of this cover type

In northern Michigan, the Chamaedaphne calyculata associa-
tion is the most ubiquitous in the region and is found extensively
in almost every peatland (Gates 1942). Andromeda glaucophylla,

66 Rhodora [Vol. 101

Kalmia polifolia, Ledum groenlandicum Oeder, and Vaccinium
oxycoccos are considered secondary components of the associa-
tion (Gates 1942). All of the heath species at Little Dollar Lake,
with the exception of L. groenlandicum, were readily apparent in
the C. calyculata CT. At Little Dollar Lake, L. groenlandicum
was scattered widely across the ericaceous scrub and was restrict-
ed to large, dry hummocks.

Schwintzer (1981) noted that ‘‘bogs’’ (i.e. poor fens) in north-
ern Michigan were often dominated by ericaceous shrubs and
Sphagnum spp. and suggested that their dominance in these hab-
itats was due to reduced rheotrophic conditions in these peatlands.
Vitt and Slack (1975) found that Chamaedaphne calyculata had
wide habitat preferences and therefore was not directly linked to
any discrete association of Sphagnum species. In the Northeast,
the C. calyculata association is affiliated with oligotrophic to om-
brotrophic sites under very wet conditions (Damman and French
1987). The dominance of C. calyculata in large expanses of peat-
land has been noted by many investigators (e.g. Crow 1969; Dun-
lop 1987; Fahey 1993; Fahey and Crow 1995; Schwintzer 1981;
Vitt and Bayley 1984; Vitt and Slack 1975).

e Chamaedaphne calyculata CT at Little Dollar Lake resem-
bled the ‘“‘closed mat zone”’ of Vitt and Slack (1975) that was
present in all eight of their northern Michigan study sites. This
zone was distinguished by the presence of a tree layer of varying
extent as well as an extensively developed ericaceous shrub layer
(Vitt and Slack 1975). There was no tree canopy or evergreen

arkland at Little Dollar Lake, despite the presence of several
coniferous tree species including Picea mariana (Miller) B.S.P,
Abies balsamea (L.) Miller, Pinus strobus L., and Larix laricina
(Duroi) K. Koch that were widely dispersed on the peatland mat.
Picea mariana and L. laricina become abundant in peatlands with
low water tables and well-drained peats (Glaser 1987). The re-
duced prominence of these species at Little Dollar Lake may be
indicative of a high water table.

€ most abundant conifer in this cover type was Pinus stro-
bus, represented by both saplings and several mature trees grow-
ing on the mat. Although P. strobus is not regarded as a wetland
tree, this species is often found within peatlands (e.g. Crow 1969;
Dunlop 1987; Fahey and Crow 1995; Miller 1996: Schwintzer
1981; C. E. Hellquist, ms. in prep.). In peatlands, P. strobus often
grows to mature heights of several meters, but these individuals

1999] Hellquist and Crow—Little Dollar Lake Peatland 67

typically are unhealthy and chlorotic (Miller 1996; C. E. Hell-
quist, pers. obs.).

2A. Sphagnum recurvum—Carex oligosperma Phase

This phase occupied expanses of grounded mat that exhibited
the undulating topography characterized by Sphagnum hummocks
that rise up to a meter above shallow, trough-like hollows (Figure
3). The species composition of the hummock-hollow complex is
maintained in part by the growth and autogenic successional
trends of Sphagnum species. Sphagnum grows apically over in-
dividuals so that their stems build up a microtopography of un-
dulating mounds (hummocks) that are supported by a scaffolding
formed by the roots and branches of vascular plant species, es-
pecially ericaceous shrubs (van Breeman 1995; Vitt et al. 1975).

A highly overlapping, directional succession of Sphagnum taxa
occurs along the hummock-hollow gradient (Andrus 1986;
drus et al. 1983; Crum 1988; Horton et al. 1979; Vitt and Slack
1984; Vitt et al. 1975). Sphagnum species characteristic of hum-
mocks have high water-storing capacity, greater capillary pull,
higher productivity under nutrient-deficient conditions, a greater
cation exchange capacity due to the higher quantities of polyu-

1982: Moore and Bellamy 1974; Rydin 1985; Spearing 1972; van
Breeman 1995; Vitt et al. 1975).

Due to the nutrient-poor nature of this cover type, the vege-
tation was dominated by Sphagnum species including S. majus,
S. recurvum, S. magellanicum Brid., and S. capillifolium (Ehrh.)
Hedw. Ericaceous species including Chamaedaphne calyculata,
Kalmia polifolia, Andromeda glaucophylla, and Vaccinium oxy-
coccos, as well as Carex oligosperma were the other ubiquitous
species of this cover type (Table 6). The four Sphagnum species
are most abundant at the acid end of the pH spectrum from ap-
proximately pH 3.7 to 5.0 (Gorham and Janssens 1992b). The
prominence of C. calyculata, C. oligosperma, and Sphagnum spp.
in open oligotrophic mats is a frequent association in northern
Michigan (Schwintzer 1981).

Hollows are depressed areas where the water table typically
pools at or just below the surface, often forming a waterlogged
trough. These niches tend to have more plentiful nutrient supplies
and higher pH values than hummocks (Crow 1969; Crum 1988;

68 Rhodora [Vol. 101

Table 6. Mean percent cover and percent frequency of dominant and as-
sociated species in the Sphagnum recurvum—Carex oligosperma phase of the
Chamaedaphne calyculata cover type (186 quadrats). Species having less
than 10% frequency are not included in the table. *TWINSPAN indicator

Mean % Cover % Frequency

BRYOPHYTES
Sphagnum recurvum* 58 85.5
Sphagnum magellanicum 34 53.8
Sphagnum capillifolium 22 29.0
Sphagnum majus* 47 25.8
Aulocomnium palustre 4 16.7
VASCULAR SPECIES
Chamaedaphne calyculata 42 98.8
Carex oligosperma 22 93.5
Kalmia polifolia 17 TAS
Andromeda glaucophylla* IS 43.0
Vaccinium oxycoccos* 25 39.2
r m ml 25.5

Moore and Bellamy 1974; Vitt and Slack 1975; Vitt et al. 1975).
Sphagnum species that inhabit hollows have a loose, flimsy ap-

Klingrr.
Sphagnum majus inhabited the lowest, dampest troughs of the

1999] Hellquist and Crow—Little Dollar Lake Peatland 69

scrub, and is a species that may grow submerged or emergent. It
is characteristic of hollows in open sedge mats and low areas in
open laggs (Crum 1983). Frequently found with S. majus in sat-
urated hollows was the moss Warnstorfia fluitans, and two liv-
erworts, the relatively abundant Cladopodiella fluitans (Nees)
Joerg., and the more scarce and minute Cephaloziella elachista
(Jack) Schiffn. Cladopodiella fluitans is typically found in sunken
microhabitats (e.g. deer trails) where water may accumulate
(Crum 1988). At Little Dollar Lake, both of these leafy liverwort
species grew in similar microhabitats and were primarily found
interwoven among moist Sphagnum stems.

Sphagnum recurvum was abundant along the upper edges of
the hollows. Colonies of S. recurvum usually blended into S. ma-
gellanicum and S. capillifolium along the sides of hummocks.
Sphagnum recurvum is known to form “loose” carpets in the
Great Lakes region (Crum 1983, 1988; Vitt et al. 1975). Sphag-
num recurvum is abundant in mesotrophic microhabitats such as
hollows in open peatland mats (Crum 1983), and thrives under
acidic conditions with low calcium and magnesium concentra-
tions (Vitt and Slack 1975). Sphagnum recurvum also has been
noted as the dominant peat moss in some Ohio peatlands (An-
dreas and Bryan 1990). In New York, S. recurvum is considered
to be indicative of ‘“‘weakly minerotrophic” conditions and is
found in poor fen habitats (Andrus 1980).

Growing among Sphagnum majus and S. recurvum was Carex
oligosperma, the most abundant sedge in the peatland. Carex oli-
gosperma inhabited open hollows throughout the grounded mat
and is abundant in acidic northern Michigan basin peatlands (Vitt
and Slack 1975). The presence of Chamaedaphne calyculata and
C. oligosperma has been associated with oligotrophic nutrient re-
gimes (Vitt and Bayley 1984). In the Red Lake peatland of Min-
nesota, heliophilous C. oligosperma is a dominant species of open
ombrotrophic and poor fen habitats within boreal patterned peat-
lands (Glaser 1987; Wheeler et al. 1983). Common species that
occur with C. oligosperma at Red Lake peatland are identical to
species found at Little Dollar Lake including Andromeda glau-
cophylla, C. calyculata, Eriophorum vaginatum L. [E. spissum
Fern.], Kalmia polifolia, Ledum groenlandicum, and Vaccinium
oxycoccos (Wheeler et al. 1983). In Maine, similar communities
dominated by S. recurvum, S. magellanicum, C. oligosperma, and

70 Rhodora [Vol. 101

C. calyculata have been delineated over wide ranges of minero-
trophic conditions (Anderson and Davis 1997).

At Little Dollar Lake, as elevation along the microtopograph-
ical gradient increased, Sphagnum recurvum abundance dwindled
and S. magellanicum became prominent. This same pattern has
been observed in other northern Michigan peatlands (Vitt and
Slack 1975; Vitt et al. 1975). In some areas of Little Dollar Lake
peatland, S. papillosum had a patchy distribution among S. ma-
gellanicum on low hummocks or on the sides of taller hummocks.
Warnstorfia fluitans, a widespread northern moss species often
found in acidic to moderately acidic conditions (Crum 1983; Jans-
sens and Glaser 1986), also tended to inhabit moist nooks on the
sides or bases of hummocks.

Near the tops of hummocks Sphagnum magellanicum faded out
of prominence and blended into compact colonies of S. capilli-
folium. Sphagnum magellanicum and S. capillifolium are typical
of poor fen (oligotrophic) mat habitats (Andrus 1980; Crum 1983,
1988). Sphagnum magellanicum and S. capillifolium are known
to initiate hummocks and grow on the sides or tops of low hum-
mocks (Crum 1983, 1988; Vitt and Slack 1975). Sphagnum ma-
gellanicum has an especially wide ecological amplitude across
the hummock-hollow complex (Vitt and Slack 1975; Vitt et al.
1975).

Hummock tops are generally considered the driest, most nu-
trient depleted, and most acidic microhabitats along the hum-
mock-hollow sequence (Andrus 1986; Crum 1988: Vitt et al.
1975). The tallest hummocks at Little Dollar Lake often were
crowned with compact populations of Sphagnum fuscum. Sphag-
num fuscum is frequently found on hummock tops (Vitt et al.
1975). Sphagnum fuscum is typical of open acid peatland habitats
and is strongly indicative of oligotrophic conditions (Crum 1983)
as well as “‘ombrotrophic to weakly minerotrophic”’ conditions
(Andrus 1986). Often intermingled with S. fuscum on larger hum-
mocks were Polytrichum strictum Brid. [P. juniperinum Hedw.
var. affine (Funck) Brid.], Calliergon stramineum, Dicranum un-
dulatum Brid., Aulocomnium palustre (Hedw.) Schwaegr., and
Bryum capillare Hedw. Polytrichum strictum is associated with
dry, oligotrophic hummock tops (Andrus et al. 1983; Crum 1983:
Janssens and Glaser 1986; Vitt 1990; Vitt et al. 1975). Calliergon
stramineum prefers damp microhabitats in bogs and fens (Crum
1983) and can inhabit acidic to moderately acidic conditions

1999] Hellquist and Crow—Little Dollar Lake Peatland pe

(Gorham and Janssens 1992b). Dicranum undulatum is typically
found in open peatland habitats especially on hummocks (Crum
1983).

An additional factor influencing the vegetation dynamics in this
cover type was the presence of the caterpillars of the Chain-Spot-
ted Geometer (Cingilia catenaria Drury, Lepidoptera: Geometri-
dae), a pale white-colored moth whose caterpillars fed voracious-
ly on ericaceous shrubs on the southwestern and southern mats
of Little Dollar Lake peatland. This caterpillar is known to be an
occasional pest on blueberry crops and has infested Ontario peat-
lands, often with severe consequences (McGuffin 1987; Reader
1979). Despite the wide-ranging feeding preferences reported for
the Chain-Spotted Geometer (Franklin 1948; McGuffin 1987), at
Little Dollar Lake it was observed specifically defoliating Cha-
maedaphne calyculata, Kalmia polifolia, and Andromeda glau-
cophylla (see Hellquist 1996 for further details of the Little Dollar
Lake infestations).

2B. Sphagnum magellanicum—Sarracenia purpurea Phase

The Sphagnum magellanicum—Sarracenia purpurea PHS
formed the relatively stable floating mat that was present within
five to twenty meters of the lake margin on all mats except the
eastern and western mats (Figure 3). This quaking mat was sit-
uated between the lake margin and the grounded mat and was
easily distinguished by level expanses of peat mosses (“‘Sphag-
num lawns’’). The Sphagnum lawns at Little Dollar Lake were
best developed along the lake margin on the northwestern, south-
western, and southern mats (Figure 3). These lawns had a gently
undulating topography that was formed primarily by carpets of
S. magellanicum, S. capillifolium, and S. papillosum. The lawn
itself had the consistency of a saturated sponge, and was covered
by sprigs of ericaceous shrubs, especially Chamaedaphne caly-
culata and Kalmia polifolia (Table 7). The height differential of
the low sprig-like ericads of the Sphagnum lawn and waist-high
shrubby ericads on the grounded mat was conspicuous.

Sarracenia purpurea L., Scheuchzeria palustris L., and Erio-
phorum virginicum L. thrived on the Sphagnum lawn where these
species obtained their greatest prominence. In Ontario, where
Chamaedaphne calyculata was less prominent, oligotrophic in-
dicator species such as Scheuchzeria palustris, Eriophorum spp.
and bryophytes including Cladopodiella fluitans, Sphagnum ma-

qT Rhodora [Vol. 101

Table 7. Mean percent cover and percent frequency of dominant and as-
sociated species in the Sphagnum magellanicum—Sarracenia purpurea phase

species.

Mean % Cover % Frequency
BRYOPHYTES
Sphagnum magellanicum 31 100.0
Sphagnum capillifolium 30 64.7
Sp majus* 28 58.8
Sphagnum papillosum 30 55.9
Sphagnum recurvum 20 38.2
Cladopodiella fluitans = 23.5
Sphagnum cuspidatum 18 a9
VASCULAR PLANTS
hamaedaphne calyculata 23 100.0
Kalmia polifolia 14 91.2
Vaccinium oxycoccos 23 88.2
Carex o. perma 20 88.2
Andromeda glaucophylla 8 67.6
Sarracenia purpurea* 10 52.9
Drosera rotundifolia 1 52.9
Eri rum virginicum 2 26.5
Rhynchospora alba 3 14.7

Jus, S. recurvum, and Warnstorfia fluitans, had an increased prev-
alence (Vitt and Bayley 1984). At Little Dollar Lake, this same
suite of species was observed on the Sphagnum lawns.

The Sphagnum lawn was also the only habitat in the peatland
where the orchids Calopogon tuberosus (L.) B.S.P. and Pogonia
ophioglossoides (L.) Ker Gawler grew. Calopogon tuberosus
grew in all Sphagnum lawn habitats, whereas P. ophioglossoides
was limited to the lawn of the northwestern mat. Both of these
orchids are abundant in northern Michigan peatlands, but were
surprisingly scarce at Little Dollar Lake.

The Sphagnum magellanicum—Sarracenia Purpurea PHS on
the northwestern floating mat was pock-marked by large, irregular
holes in the mat that often were colonized by two submerse
species, Potamogeton confervoides Reichb. and Utricularia gem-
iniscapa Benj. Presumably, these holes had been accentuated and
possibly maintained by beaver activity. The edges of these holes
were fringed with exposed peat and were the only sites for Ly-

1999] Hellquist and Crow—Little Dollar Lake Peatland 73

copodiella inundata (L.) Holub [Lycopodium inundatum L.] and
Drosera intermedia Hayne. Other species that grew on this ex-
posed peat included D. rotundifolia L., Eriocaulon aquaticum
(Hill) Druce [E. septangulare With.], Menyanthes trifoliata L.,
Rhynchospora alba (L.) Vahl., and the liverwort Cladopodiella
fluitans.

The Sphagnum magellanicum—Sarracenia purpurea PHS
closely resembled a similar community at Mud Pond Bog (Moul-
tonborough, NH). Both lawn communities were saturated, spong
habitats extensively colonized by insectivorous plants (Sarracenia
purpurea, Drosera intermedia, and D. rotundifolia), as well as
stunted ericaceous species, especially Chamaedaphne calyculata
(C. E. Hellquist, ms. in prep.). These lawn habitats at Moulton-
borough were also the preferred habitats of Pogonia ophioglos-
soides and Calopogon tuberosus (C. E. Hellquist, ms. in prep.)
and corresponded well to the Sphagnum lawn concept of Crum
(1988). The Vaccinium oxycoccos—Rhynchospora alba subtype of
Mud Pond Bog (Hillsborough, NH), characterized by dwarfed
ericaceous shrubs as well as D. rotundifolia and S. purpurea
(Dunlop 1987), also was similar to the species assemblage at
Little Dollar Lake. In Ohio, similar species inventories have

een recorded in Sphagnum lawn communities (Andreas and
Bryan 1990).

3. Chamaedaphne calyculata—-Triadenum fraseri Cover Type

e Chamaedaphne calyculata—Triadenum fraseri CT was
composed of two phases that exhibited possible terrestrialization
patterns in two distinct areas of the peatland. One phase of this
cover type was associated with terrestrialization at the lake mar-
gin (the Sphagnum papillosum PHS) and the other phase was
associated with terrestrialization of the stream channel (the S.
majus PHS; Figure 3). This cover type has been renamed and is
identical to the C. calyculata—Carex lasiocarpa CT first described
by Hellquist (1996) at Little Dollar Lake.

This cover type represents a hybrid association colonized by
species common to both the Chamaedaphne calyculata CT and
the Calamagrostis canadensis CT (Table 8). Few species were
restricted to this cover type, thus it is defined more by the absence
of certain species than those present in its marsh-like physiog-
nomy. Despite its low cover value, Triadenum fraseri (Spach)
Gleason was a frequent component of this cover type and was

74 Rhodora [Vol. 101

Table 8. Mean percent cover and percent frequency of dominant and as-
sociated species in the Chamaedaphne calyculata—Triadenum fraseri cover
type (32 quadrats). Species having less than 10% frequency are not included
in the table. *TWINSPAN indicator species. Sphagnum cuspidatum also was
designated as an indicator species, but does not appear in the table.

Mean % Cover % Frequency

BRYOPHYTES
Sphagnum recurvum* 45 50.0
Sphagnum majus* 60 34.4
Sphagnum papillosum* 44 28.1
Sphagnum magellanicum 13 18.8

VASCULAR PLANTS
Chamaedaphne calyculata 44 93.8
Triadenum fraseri fa, 59.4
Carex lasiocarpa 31 56:3
Carex oligosperma* 15 34.4
Vaccinium macrocarpon 26 34.4
Carex ca - 25 25.0
Calamagrostis canadensis 24 21.9
Drosera rotundifolia 21.9

1
Carex utriculata 4
Glyceria canadensis 2
Acer rubrum <1 18.8
Potentilla palustris 3
Sarracenia purpurea* 4

readily apparent with its distinct growth form and reddish-hued
foliage (Table 8). Triadenum fraseri was commonly seen in more
minerotrophic microhabitats along the lakeshore, stream channel,
and in the lagg.

Although prominent in the Calamagrostis canadensis CT, Car-
ex lasiocarpa was also conspicuous in this cover type with a
cover of 31% and 56.3% frequency. In the stream channel, the
distinct physiognomy of the C. lasiocarpa community traced the
course of the stream channel from its origin in the muck pools
of the southern mat extension, through the ericaceous scrub of
the southern mat to the open water of the lake (Figures 1 and 3).

Carex lasiocarpa is indicative of more minerotrophic condi-
tions (e.g., Crum 1988; Jeglum 1971; Schwintzer 1978; Vitt and
Bayley 1984; Vitt and Slack 1975). With its prolific interlaced
rhizome sytems, C. lasiocarpa is one of the most important lake-
fill species that can initiate the process of terrestrialization along
shorelines (Gates 1942). In northern Michigan, C. lasiocarpa is

1999] Hellquist and Crow—Little Dollar Lake Peatland 75

Table 9. Mean percent cover and percent frequency of dominant and as-
sociated species in the Sphagnum majus phase of the Chamaedaphne caly-
culata—Triadenum fraseri cover type (22 quadrats). Species having less than
10% frequency are not included in the table. TWINSPAN indicator species.

Mean % Cover % Frequency

BRYOPHYTES
Sph eb recurvum* 51 63.6
Sphagnum majus* 64 45.5

VASCULAR PLANTS
Chamaedaphne calyculata 43 95.5
Carex oligosperma* 15 45.5
Calamagrostis canadensis* 28 219
Vaccinium macrocarpon* 40 25S
Carex utricu 5 0 Ue |
Glyceria canadensis 3 22-0
Acer rubrum <1 Fb ied
Potentilla palustris 5 18.2
Drosera dunia <1 18.2
Carex canescen 8 13.6

the primary mat-forming species along more alkaline lake mar-
gins with circumneutral pH values (Crum 1988; Vitt and Slack
1975). A circumneutral sedge mat dominated by C. lasiocarpa
has also been noted in southern Michigan (Crow 1969). At Red
Lake peatland in Minnesota, C. lasiocarpa was the most abundant
vascular plant in open rich fens (Wheeler et al. 1983). Similarly,
in north-central New Hampshire, the presence of C. /asiocarpa
along lake edges and in wet habitats with a fen-like flora has also
been noted (Fahey and Crow 1995; C. E. Hellquist, ms. in prep.).

3A. Sphagnum majus Phase

The Sphagnum majus PHS was a relatively minerotrophic
phase that was contained within the stream channel that origi-
nated in the southeastern lagg of the southern mat extension, and
eventually reached the open water of Little Dollar Lake. The S.
majus PHS also comprised the narrow eastern and western mats
(Figure 3). Both of these mats bordered steep upland slopes and
were dominated by S. majus and S. recurvum (Table 9). Con-
spicuous vascular plants on these mats included Carex canescens,
C. lasiocarpa, Calla palustris L., Chamaedaphne calyculata,
Vaccinium macrocarpon Aiton, and Triadenum fraseri. The rel-
ative minerotrophy of this vegetation phase was strongly sug-

76 Rhodora [Vol. 101

gested by the presence of S. subsecundum. This minerotrophic
species is often found in open, wet lagg habitats and sedge mats
(Andrus 1980; Crum 1983, 1988), and has been shown to grow
in moderately acidic habitats (ca. pH 4.5—6.0; Gorham and Jans-
sens 1992b). This phase was the only area in the peatland where
S. subsecundum grew in abundance (Hellquist and Crow 1997).

3B. Sphagnum papillosum Phase

e Sphagnum papillosum PHS occurred along the majority of
the lake margin. This community was distinguished by a narrow
swath (~1.0 m) of Chamaedaphne calyculata and Kalmia poli-
folia intermingled with Vaccinium macrocarpon and Triadenum
fraseri that extended into the open water of the lake. Immediately
behind this band of C. calyculata was a wet trough with some
standing water, colonized primarily by S. papillosum, Carex ca-
nescens L., C. limosa L., and Rhynchospora alba. Although sam-
pled infrequently, C. limosa was a major component of this phase.
Other species frequent in this trough included Cladopodiella flui-
tans, Sphagnum cuspidatum, S. recurvum, Carex lasiocarpa, and
Sarracenia purpurea (Table 10).

The Sphagnum papillosum PHS of Little Dollar Lake closely
resembled an ‘‘acid lake edge” community (Crum 1988; Vitt and
Slack 1975) that was also observed at Heath Pond Bog, New
Hampshire (Fahey 1993). The acid lake vegetation sequence is
characterized by the lack of vascular macrophytes in the lake
itself, the presence of Chamaedaphne calyculata growing out into
open water, Sphagnum as a pioneer among C. calyculata, fre-
quently a “sparse Carex fringe”’ along the lake, and a narrow
Sphagnum lawn that quickly merges into a grounded mat (Crum
1988).

Vitt and Slack (1975) defined the “acid lake edge” community
by the presence of a Sphagnum cuspidatum—Sphagnum papillos-
um—Carex limosa—Carex paupercula association and a pH range

tats (Vitt and Slack 1975), although along the lake margin at
Little Dollar Lake (mean pH = 4.5, n = 40) S. papillosum grew
both emergent above the water level, and partially submerged

1999] Hellquist and Crow—Little Dollar Lake Peatland 77

Table 10. Mean percent cover and percent frequency of dominant and
associated species in the Sphagnum papillosum phase of the Chamaedaphne
calyculata—Triadenum fraseri cover type (10 quadrats). Species having less
than 20% frequency are not included in the table. *TWINSPAN indicator
species.

Mean % Cover % Frequency

BRYOPHYTES
Sphagnum papillosum 49 80.0
Sphagnum magellanicum 9 40.0
Sphagnum cuspidatum 41 40.0
Sphagnum recurvum 3 20.0
Sphagnum capillifolium 10 20.0
VASCULAR PLANTS
Chamaedaphne calyculata 47 90.0
Triadenum fraseri - 80.0
Carex canescens 36 50.0
Vaccinium macrocarpon 10 50.0
Carex lasiocarpa* 22 40.0
Sarracenia purpure 4 40.0
Drosera rotundifolia 30.0
Eriocaulon aquaticum 2a 30.0
Kalmia polifolia 3 30.0
Vaccinium oxycoccos 1 30.0
Rhynchospora alba <l 20.0
Scheuchzeria palustris 5 20.0
Utricularia geminiscapa <1 20.0

among Chamaedaphne calyculata branches in the lake (Hellquist
1996).
In northern Michigan, Sphagnum papillosum is known to in-
habit wetter, more mineral rich habitats on mats or lake margins
influenced by water movement (Crum 1983, 1988). In Ontario,
S. papillosum is also associated with lake edge vegetation se-
quences (Vitt and Bayley 1984). The liverwort Cladopodiella
fluitans also seems to indicate the acid nature of the lake margin
community based on its preferred pH range of 3.7 to 5.0 (Gorham
and Janssens 1992b). In Maine, sedge-moss lawn communities
characterized by S. papillosum, S. magellanicum, Carex limosa,
Rhynchospora alba, and Scheuchzeria palustris were found in
‘‘very acidic” to “‘moderately acidic” fens (Anderson and Davis

‘
Vitt and Slack (1975) cite Carex limosa as being essentially
restricted to this zone. At Little Dollar Lake, C. limosa was pri-

78 Rhodora [Vol. 101

marily found along the lake margin with the exception of a few
scattered localities in wet areas of the Calamagrostis canadensis
CT. Of the four species described as characteristic of this com-
munity by Vitt and Slack (1975), only Carex paupercula Michx.
was absent at Little Dollar Lake.

4. Potamogeton confervoides—Utricularia geminiscapa
Cover Type

The depauperate aquatic flora of Little Dollar Lake reflected
the acidity of the lake water. The aquatic flora consisted of three
submersed species (Jsoétes echinospora Durieu, Utricularia gem-
iniscapa, and Potamogeton confervoides) and two floating species
(Nuphar variegata Durand and Nymphaea odorata Aiton). Two
submersed and/or emergent species, Eriocaulon aquaticum and
Hypericum boreale (Britton) E. Bickn. forma callitrichoides Fas-
sett, were also present in or along the lake (Hellquist 1996; Hell-
quist and Crow 1997).

Potamogeton confervoides and Utricularia geminiscapa were
concentrated along the periphery of the floating mat, among the
submerged rhizomes and roots of ericaceous shrubs growing into
the open water of the lake. While P. confervoides was especially
abundant and fruited copiously in the summer of 1994, it seemed
less abundant in 1995, and was not fruiting as prolifically as in
1994. In 1996 the population continued to recede, with the ma-
jority of the population scattered along the lake margin of the
eastern and southern mats. Previously, it had been found around
the entire circumference of the lake

In Michigan, Potamogeton confervoides occurs locally in lakes
and acid bogs (Voss 1972) and is listed as a state of Michigan
Threatened Species (Anonymous 1994; Beaman et al. 1985), al-
though its status as Threatened may be due to under-collection
rather than to actual rarity. In New England, P. confervoides is
associated with soft waters, including high elevation ponds and
lakes (Hellquist 1980). It is characteristic of extremely acidic wa-
ters with low alkalinity values (maximum alkalinity value 8.5 mg/l
CaCO,) and is the only pondweed found in Sphagnum bog ponds
(Hellquist 1980).

Utricularia geminiscapa was also found submersed along the
edge of the floating mat. In New England, U. geminiscapa is
associated with bog ponds and acidic to moderately alkaline wa-
ters with a pH of 3.5-8.6 and alkalinity of 5.4-69.5 mg/l CaCO,

1999] Hellquist and Crow—Little Dollar Lake Peatland 79

(Crow and Hellquist 1985). Like Potamogeton confervoides, the
abundance of U. geminiscapa was noticably lower in 1996 than
in the two previous years.

Isoétes echinospora grew submersed in the sandy sediments on
the bottom of Little Dollar Lake. Individuals tended to grow
widely scattered and were most conspicuous in shallow water off
the eastern mat. In 1996, Hypericum boreale forma callitrichoi-
des, an aquatic to partially emergent growth form, was thriving
in the water along the edge of the eastern mat.

Evidence of terrestrialization and small-scale paludification
processes at Little Dollar Lake. In an analysis of the pollen
and sediment stratigraphy of Little Dollar Lake, Futyma (1982)
stated that since the formation of the peatland approximately 3500
years before present, at least fifty percent of the surface area of
Little Dollar Lake had been covered by peatland vegetation. At
the time of this study, evidence of these terrestrialization patterns
was visible at Little Dollar Lake in the former stream channel as
well as in the muck pool area of the southern mat extension.

Apparent botanical evidence of terrestrialization was observed
in the muck pools of the Sphagnum cuspidatum—Dulichium arun-
dinaceum PHS of the Calamagrostis canadensis CT, and in the
various areas of the S. majus and S. papillosum phases of the
Chamaedaphne calyculata-Triadenum fraseri CT (Hellquist
1996). In these areas there was evidence from relict aquatic veg-
etation, as well as from aerial photography, that previously aquat-
ic habitats were being colonized by emergent wetland vegetation
(Hellquist 1996).

At Little Dollar Lake peatland, apparent on-going terrestriali-
zation was most conspicuous at the muck pools in the southeast-
ern lagg of the southern mat extension. These muck pools ex-

rienced conditions that vacillated between exposure and sub-
mergence. Along the edges of these mucky areas Chamaedaphne
calyculata, Carex lasiocarpa, Dulichium arundinaceum, and Gly-
ceria canadensis, as well as other emergent vascular species, were
well established and were apparently encroaching into the open
areas of peaty muck.

In 1994 and 1995, the muck pools contained stranded aquatic
vascular plant species that were directly subjected to the fluctu-
ating water levels of the peatland. One of the stranded aquatic
species was Potamogeton oakesianus Robbins, which grew stunt-

80 Rhodora [Vol. 101

ed and infertile with ‘floating’ leaves lying on the surface of the
mucky peat. Another stranded aquatic species, Sparganium min-
imum (Hartman) Fries, was found fruiting abundantly along the
edges of the muck pools. Utricularia intermedia Hayne also grew
in the peaty muck. In 1995, U. intermedia was extremely scarce
with less than ten individuals located. However, when the muck
pools were flooded in 1996, U. intermedia was frequent, with
many lush, thriving individuals growing among the emergent veg-
etation.

There was also evidence of terrestrialization in the stream chan-
nel that wound through the southern mat and southern mat ex-
tension. The intermittently aquatic stream channel was colonized
by a tenuous, loose network of Carex lasiocarpa that readily sank
and quaked extensively when walked upon. This channel was also
home to approximately 25 emergent clusters of stranded Nuphar
variegata that were surrounded entirely by C. lasiocarpa and
scattered individuals of Potentilla palustris in an approximately
3.0 m X 3.0 m area (Hellquist 1996). In a 1978 infrared aerial
photograph, this stream channel was visible as open water where-
as 1995 aerial photos and concurrent ground surveys clearly
showed that, although still visible, the channel had become en-
tirely covered by a quaking mat of vegetation dominated by C.
lasiocarpa (see Hellquist 1996 and Hellquist and Crow 1997 for
photographs).

Water levels in 1994 and 1995 were relatively low, but in 1996
the stream channel and muck pool areas became partially sub-
merged by high water levels. In most areas, the Sphagnum majus
PHS was covered by water with a minimum depth of ca. 20 cm.
Presumably during high water years, terrestrialization by emer-
gent sedges and other wetland taxa such as Potentilla palustris
probably does not progress as rapidly as in drier years. Therefore,
if the peatland experiences more dry years than wet years, ex-
pansion of the sedge-dominated mat would continue, and peat
deposition and plant colonization would further promote terres-
trialization. This process could occur relatively rapidly in an area
as confined as the stream channel.

A similar rapid terrestrialization process has occurred at Weber
Lake Bog in Cheboygan County, Michigan. A small pool of open
water fringed by Carex lasiocarpa was mapped by University of
Michigan Biological Station ecology classes in 1967 (Vitt and
Slack 1975). When examined by Vitt and Slack in the mid-1970s

1999] Hellquist and Crow—Little Dollar Lake Peatland 81

neither the open water nor C. lasiocarpa was present. The pool
was replaced by an open mat community with stranded clumps
of Dulichium arundinaceum. During the summer of 1995, the
area that had once been open water was still apparent, and con-
tained stranded individuals of Nuphar variegata, as well as a few
isolated individuals of C. limosa. Carex lasiocarpa has remained
absent at Weber Lake Bog (E. G. Voss and C. E. Hellquist, pers.
obs. 1995).

In some lagg areas of the Jris versicolor—Lycopus uniflorus
PHS at Little Dollar Lake, small-scale paludification was ob-
served where Sphagnum spp. were growing onto upland slopes.
The process of paludification often is associated with rising water
levels, especially in shallow, flat basins (Crum 1988). In some
basin peatlands in northern Michigan, paludification is initiated
by the compression of the lowermost peat layers. These com-
pacted layers become so tightly condensed that they act as a seal-
ant that prevents water from percolating out of the basin. Thus,
any water entering the basin is retained by the more porous upper
peat layers (Futyma 1982). This sequence is believed to have
resulted in paludification at other Michigan peatlands, including
Tahquamenon Bog and the Trout Lake peatlands in Chippewa
County (Futyma 1982) and Lake Sixteen peatland in Cheboygan
County (Futyma and Miller 1986). At Little Dollar Lake, the
gradual creep of Sphagnum onto upland soils in some areas can
probably be attributed to pooling of water trapped in the lagg.

Based on pollen and stratigraphic analysis from Futyma (1982),
as well as field and photographic evidence described by Hellquist
(1996) and Hellquist and Crow (1997) there seems to be satis-
factory botanical evidence illustrating terrestrialization and pal-
udification processes at Little Dollar Lake peatland. The patterns
observed follow the ‘“‘bog climax model’’ of peatland succession
proposed by Klinger (1996), where areas of water are colonized
by extensive, but irregular growth of vegetation while paludifi-
cation proceeds as peat is deposited over upland soils along the
margin of the bog basin. At Little Dollar Lake the areas along
the lakeshore, stream channel, and muck pools with stranded
aquatic taxa seem to be indicative of terrestrialization processes
whereas paludification is less easily discerned, but still present in

some lagg areas.

Little Dollar Lake peatland classification. The majority of

82 Rhodora [Vol. 101

northern Michigan peatlands exist in glacial topography and re-
main under the influence of local hydrology. Despite the fact that
most of these peatlands are dominated by Sphagnum, they are
best classified as fens (Vitt et al. 1975). Little Dollar Lake cor-
responds well to the delineation of a northern Michigan poor fen
or “bog”’ (i.e. a more acid, oligotrophic peatland) as defined by
Schwintzer (1981). Schwintzer (1981) states that these peatlands
are weakly minerotrophic with low pH values (3.8—4.3) and low
concentrations of calcium cations (1.2-3.7 mg/L). These poor fen
complexes have a prominent Sphagnum cover, low vascular spe-
cies richness, well developed open areas dominated by ericaceous
shrubs, and reduced tree cover (Schwintzer 1981).

This study and its companion studies (Hellquist 1996; Hellquist
and Crow 1997) have documented the flora and described the
vegetation patterns within Little Dollar Lake peatland. This anal-
ysis, used in conjunction with the postglacial history of the Little
Dollar Lake basin (Futyma 1982), has laid a foundation for sub-
sequent studies that may further elucidate the dynamic processes
(e.g., hydrology, nutrient regimes, interspecific plant interactions,
plant-herbivore interactions, successional patterns) that influence
the abundance and distribution of peatland vegetation at Little
Dollar Lake.

ACKNOWLEDGMENTS. The senior author wishes to thank to Dr
Thomas Lee and Scott Miller for their patient assistance with
TWINSPAN; Dr. Lee and Dr. Janet Sullivan also provided advice
and editiorial suggestions on earlier drafts of this research; Dr.
Edward Voss encouraged this project and has provided generous
support throughout its duration from specimen annotations to
comments on early thesis drafts; Dr. Howard Crum kindly as-
sisted with bryophyte taxonomy; the efforts of Dean I. Reid and
the staff of the Naubinway Field Office of the Michigan Depart-
ment of Natural Resources are also appreciated; the technological
expertise of Chris Cerrudo was essential to the completion of
various graphics. The thoughtful editorial comments and sugges-
tions of two anonymous reviewers were also appreciated. The
financial and logistical support of both the University of New
Hampshire Department of Plant Biology and the University of
Michigan Biological Station (including a Henry Allan Gleason
Fellowship to the senior author in 1995) is gratefully acknowl-
edged. This study was conducted in partial fulfillment of the re-

1999] Hellquist and Crow—Little Dollar Lake Peatland 83

quirements for the Master of Science degree in Plant Biology for
the University of New Hampshire, Durham, NH. This paper is
Scientific Contribution No. 1984 from the New Hampshire Ag-
ricultural Experiment Station.

LITERATURE CITED

ANDERSON, D. S. AND R. B. Davis. 1997. The vegetation and its environments
in Maine peatlands. Canad. J. Bot. 75: 1785-1805.

ANDREAS, B. K. AND G. R. BRYAN. 1990. The vegetation of three Sphagnum
dominated basin-type bogs in northeastern Ohio. Ohio J. Sci. 90: 54—

66.
ANnprus, R. E. 1980. Sphagnaceae (Peat Moss Family) of New York State.
Contributions to a Flora of New York State III. N.Y. State Museum Bull.
o. 422

. 1986. Some aspects of Sphagnum ecology. Canad. J. Bot. 64: 416—
426.

. J. WAGNER, AND J. E. Titus. 1983. Vertical zonation of Sphagnum

concern, and probably extirpated. Endangered Species Program of the
Michigan Department of Natural Resources and the Michigan Natural
Features pete sine MI.

BEAMAN, J. oe A. Bourpo, FE W. Case, S. R. Crispin, D. HENSON, R. —
Pippen, A. A. aheacvonts E. G. Voss, AND P. W. THOMPSON. 1985.
dangered and threatened vascular plants in Michigan. II. Third aces
review proposed list. Mich. Bot. 24: 99-116

Criymo, R. S. 1963. Ion-exchange in Sphagnum and its relation to bog ecol-
ogy. Ann. Bot., n.s. 27: 309-324.

. 1964. The origin of acidity in Sphagnum bogs. Bryologist 67: 427—

431.
AND P. M. Haywarp. 1982. The ecology of Sphagnum, pp. 229-289.
In: = J. E. Smith, ed., Bryophyte Ecology. Chapman and Hall, New

Yor!

Crow, = E. 1969. An ecological analysis of a southern Michigan bog. Mich.
Bot cn 11-27.

pC. B. HELLQutst. 1985. Aquatic Vascular Plants of New England.
bak 2. Lentibulariaceae. New Hampshire Agric. Exp. Sta. Bull. 528.

Crum, H. A. 1983. Mosses of the Great Lakes Forest, 3rd ed. Univ. Michigan
Herbarium, Ann Arbor, MI.

_ 1988. A Focus on Peatlands and Peat Mosses. Univ. Michigan Press,
Ann Arbor, MI.

Daman, A. W. H. AND T. W. FRENCH. 1987. The ecology of peat bogs of
the glaciated northeastern United States: A community profile. U.S. Fish
Wildl. Serv. Biol. Rep. 85(7.

DANSEREAU, P. AND F SEGADAS- VIANNA. 1952. Ecological study of peat bogs
of eastern North America. I. Structure and evolution of vegetation. Can-
ad. J. Bot. 30: 490-520

84 Rhodora [Vol. 101

ne D. A. 1987. Community classification of the vascular vegetation of
w Hampshire peatland. Rhodora 89: 415—440.

Fas, L. L. 1993. A vegetation, floristic, and phytogeographic analysis of

o New Hampshire peatlands. M.S. thesis, Univ. New Hampshire, Dur-
ey NH.

AND G. E. Crow. 1995. The vegetation of Pequawket Bog, Ossipee,

New Hampshire. Rhodora 97: 39-92.

FRANKLIN, H. J. 1948. Cranberry Insects in Massachusetts. Massachusetts

ic. Exp. Sta. Bull.
FutyMa, R. P. 1982. Postglacial vegetation of eastern Upper Michigan. Ph.D.
pre Univ. Michigan, Ann Arbor, MI.

N. G. MILLER. 1986. Stratigraphy and genesis of the Lake Six-
nt aeuieak northern Michigan. Canad. J. Bot. 69: 3008-3019.
Gates, F C. 1942. The bogs of northern lower Mickdeans Ecol. Monogr. 12:
Gaucu, H. G. 1982. Multivariate Analysis in Community Ecology. Cam-
bridge Univ. Press, New York.
Gicnac, L. D. AND D. H. Vitr. 1994. Responses of northern peatlands to
climate change: Effects on bryophytes. J. Hattori Bot. Lab. 75: 119-132.
GLASER, P. H. 1987. The ecology of patterned boreal peatlands of northern
Minnesota: A community profile. U.S. Fish Wildl. Serv. Biol. Rep.

Gore, A. J : P 1983. Introduction, pp. 1-34. In: A. J. P. Gore, ed., Ecosystems
of the World. 4A. Mires: Swamp, Bog, Fen, and Moor. Elsevier, Am-

sterdam.
GorHAM, E. 1957. The development of peatlands. Quart. Rev. Biol. 32: 145—
166

. 1961. Factors influencing supply of major ions to inland waters, with
i references to the atmosphere. Bull. Geol. Soc. Amer. 72: 795—

ate Biotic impoverishment in northern peatlands, pp. 65-98. J

G. M. Woodwell, ed., The Earth in Transition: Patterns and Processes
Biotic Impoverishment. Cambridge Univ. Press, New York.

. A. JANSSENS. 1992a. The paleorecord of geochemistry and
hydrology of northern peatlands and its relation to global change. Suo
43: fica 126.

———.. 1992b. Concepts of fen and bog re-examined in relation
to myopic cover and the acidity of surface waters. ACTA Soc. Bot.
Poloniae 61: 7—20.
HELLQuisT, C. B. 1980. Correlation of alkalinity and the distribution of Po-
tamogeton in New England. Rhodora 82: 331-344.
pe C. E. 1996. A flora and analysis of the bryophyte and vascular
communities of Little Dollar Lake peatland, Mackinac County,
pesiheas M.S. thesis, Univ. New Hampshire, Durham, NH.
AND G. E. Crow. 1997. The bryophyte and vascular flora of Little
Dollar Lake peatland, Mackinac County, Michigan. Rhodora 99: 195—
222.

HEMoND, H. F 1980. Biogeochemistry of Thoreau’s bog, Concord, Massa-
chusetts. Ecol. Monogr. 50: 507-526.

1999] Hellquist and Crow—Little Dollar Lake Peatland 85

Hitt, M. O. 1979. TWINSPAN—A FORTRAN program for arranging mul-
tivariate data in an ordered two-way table by classification of the indi-
viduals and attributes. Ecology and Systematics, Cornell Univ., Ithaca,

Horton, D. G., D. H. Vitt, AND N. G. SLACK. 1979. Habitats of circumbo-
ae Sphagna: I. A quantitative analysis and review of species
in the Caribou Mountains, northern Alberta. Canad. J. Bot. 57: 2283-—
23

eS
i J. A. AND P. H. GLASER. 1986. The bryophyte flora and major peat
rming mosses at Red Lake peatland, Minnesota. Canad. J. Bot. 64:
—442.
JeEcLuM, J. K. 1971. Plant indicators of pH and nese o in peatlands at
Candle Lake, Saskatchewan. Canad. J. Bot. 49: —1676.
KILHAM, P. 1982. The biogeochemistry of bog hone and the chemical
ecology of Sphagnum. Mich. Bot. 21: 159-168.
Kurncer, L. E 1996. The myth of ~ classic hydrosere model of bog suc-
cession. opi Alpine Res. 28:
McGurrin, W. C. 1987. Guide to “he Geciieisides of Canada ca i aie
II. Subfamily once 4. Mem. Entom. Soc. Canada, no. 138.
Miter, S. D. 1996. A vegetation and dendroecological slates of Sa
le Bog, Durham, NH. M.S. thesis, Univ. New Hampshire, Durham

Moore, P. D. AND D. J. BELLAMY. 1974. Peatlands. Springer-Verlag, New

York.
PieLou, E. C. 1979. Biogeography. John Wiley and Sons, New York.
READER, R. 1979. Impact of leaf-feeding insects on three bog ericads. Canad.
J. Bot. 57: 2107-2112
Rice, S. K. AND P. H. Scueupp. 1995. On the ecological and evolutionary
significance of branch and leaf morphology in aquatic Sphagnum
3-846.

(Sphagnaceae). Amer. J. Bot. 82: 833
Risser, P. G. 1995. The status of the science examining ecotones. BioScience
4S: 318- 325.

Rypin, H. 1985. Effect of water level on dessication of Sphagnum in relation
to surrounding Sphagna. Oikos 45: 374-379.

SCHWINTZER, C. R. 1978. Vegetation and nutrient status of northern Michigan
fens. Canad. J. Bot. 56: 3044-3051.

_ 1981. Vegetation and nutrient status of northern Michigan bogs and

conifer swamps with a comparison to fens. Canad. J. Bot. 59: 842-853.

p G. WILLIAMS. 1974. Vegetation changes in a small Michigan bog
aha 1917 to 1972. Amer. Midl. Nat. 92: 447-459

SHIMWELL, D. W. 1971. The Description and Classification of Vegetation.

niv. ie

SLACK, N. G., D. H. Vitt, AND D. G. Horton. 1980. Vegetation gradients of

minerotrophically rich oo in western Alberta. Canad. J. Bot. 58: 330—
350.

SPEARING, A. M. 1972. Cation-exchange capacity and galacturonic acid con-
tent of several species of Sphagnum in Sandy Ridge Bog, Central New

York State. Bryologist 75: 154-158.
TRANSEAU, E. N. 1903. On the geographic distribution and ecological rela-

86 Rhodora [Vol. 101

tions of the bog plant societies of northern North America. Bot. Gaz.
36: 401—420.

VAN BREEMAN, N. 1995. How Sphagnum bogs down other plants. Trends Ecol.
Evol. 10: 270-275

VAN TONGERAAN, O. E R. 1987. Cluster sea = 174-212. In: R. H. G.

ongman, C. J. E ter Braak, and O. FE R. van Tongeren, eds., Data Anal-
ysis in Community and Landscape oe Pudoc, Wageningen, Neth-
erlands.

Virt, D. H. 1990. Growth and production rages of boreal mosses over cli-
matic, chemical and topographic gradients. J. Linn. Soc. Bot. 104: 35—59.

AND S. BAYLEY. 1984. The eae and water chemistry of four

oligotrophic basin mires in northwestern Ontario. Canad. J. Bot. 62:

1485-1500.

AND W.-L. CHEE. 1990. The relationship of vegetation to surface wa-

ter chemistry and peat chemistry in fens of Alberta, Canada. Vegetatio

89: 87-106.

» H. A. Crum, AND J. A. SNIDER. 1975. The vertical zonation of Sphag-
num species in hummock-hollow complexes in northern Michigan. Mich.
Bot. 14: 190-200.

———, D. G. Horton, N. G. SLACK, AND N. MALMER. 1990. Sphagnum-
dominated peatlands of the hyperoceanic British Columbia coast: Pat-
terns in surface water chemistry and vegetation. Canad. J. For. Res. 20:
696-711.

» Y. Li, AND R. J. BELLAND. 1995. Patterns of bryophyte diversity in
peatlands = continental western Canada. Bryologist 98: 218—227.

N. G. Stack. 1975. An analysis of the vegetation of Sphagnum-
phi kettle hole bogs in relation to environmental gradients. Canad.
J. Bot. 53: 332-359.

AND . 1984. Niche diversification of Sphagnum relative to en-
vironmental factors i in northern Minnesota peatlands. Canad. J. Bot. 62:
1409-1430.

Voss, E. S. 1972. Michigan Flora. Part I. Gymnosperms and Monocots. Cran-
pati Institute of Science Bull. 55 and Univ. Michigan Herbarium, Ann

Ar
aaa a e P. H. Graser, E. Goruam, C. M. WETMoRE, FE D. Bowers,
Dib. «Ay Janssens 1983. Contributions to the flora of the Red Lake

a » northern Minnesota, with special attention to Carex. Amer.
Midl. Natl. 110: ae

RHODORA, Vol. 101, No. 905, pp. 87-91, 1999

NOTE

MORE MOLECULAR EVIDENCE FOR INTERSPECIFIC
RELATIONSHIPS IN LIQUIDAMBAR
(HAMAMELIDACEAE)

JIANHUA LI AND MICHAEL J. DONOGHUE

Harvard University Herbaria, 22 Divinity Ave.,
Cambridge, MA 02138

There are four species of Liqguidambar L. (Altingioideae, Ha-
mamelidaceae). Liguidambar orientalis Miller occurs in western
Asia and L. styraciflua L. in Northern and Central America, while
L. acalycina Chang and L. formosana Hance are found in south-
eastern Asia (Bogle 1986). A phylogenetic analysis has recently
been conducted based on DNA sequences of the plastid gene
matK (Li et al. 1997a). Li et al. found that the western Asian
species L. orientalis is most closely related to the New World
species L. styraciflua. This result is consistent with an earlier
allozyme study (Hoey and Parks 1991). The finding is significant
because it suggests a possible phytogeographical connection be-
tween the western Eurasian continent and the New World.

The close relationship of Liguidambar styraciflua and L. or-
ientalis is moderately well supported by bootstrap values in the
matK analysis and no homoplasy was found. However, there are
only seven phylogenetically informative characters in the data set.
Therefore, it is desirable to gather more evidence to test this phy-
logenetic hypothesis. In this note, we report recent progress.

Three more regions of DNA have been sequenced, including
the ITS (Internal Transcribed Spacer) region of nuclear ribosomal
DNA (Baldwin et al. 1995), the intron of chloroplast gene trnL
(Taberlet et al. 1991), and the exon 9-exon 12 region of the GBSS
(Granule-Bound Starch Synthase) gene (Dai et al. 1996; Mason
and Kellogg, unpubl. data).

DNA extraction, sequencing reactions, and PCR (Polymerase
Chain Reaction) amplification for ITS were conducted as de-
scribed in Li et al. (1997b, 1997c). PCR amplification of the trnL
intron was carried out using primers c and d of Taberlet et al.
(1991) with a thermocycler program of 30 cycles of 94°C for 35
sec., 55°C for 30 sec., and 72°C for 95 sec. The final cycle was

88 Rhodora [Vol. 101

followed by a seven minute extension at 72°C. PCR amplification
of the GBSS gene was conducted using primers GBSSF2
(5’TGGCATGGATACCCAAGAGT3’) and GBSSR2 (5’'CCTTC-
TTTCACAGTGTCAAC3’). We have successfully amplified a
fragment of about 800 base pairs for several flowering plant taxa,
including Hamamelis (Hamamelidaceae), Stewartia (Theaceae),
and Viburnum (Adoxaceae). The thermocycler program consisted
of a 60 sec. hotstart at 96°C and 40 three-temperature cycles,
followed by a 15 minute extension at 72°C. Each cycle had de-
nature and extension temperatures of 96°C for 60 sec. and 72°C
for 90 sec., respectively. The annealing temperatures were 56°C,
54°C, and 52°C for the first two cycles, the second two, and the
remaining 36 cycles, respectively. The annealing time was 60 sec.
for all cycles. Sequencing reactions were carried out using Amer-
sham cycle sequencing kit (Amersham Life Science Inc., Arling-
ton Heights, IL) and following the manufacturer’s instructions.
Sequences were determined with an ABI 377 automated sequenc-
er (Applied Biosystems, Inc. Foster City, CA). We obtained 348
base pairs from the ITS region (partial 5.8S plus ITS-2), 524 sites
from the frnL intron, and 776 base pairs from the GBSS gene.

The parsimony analyses were conducted using the exhaustive
tree search option of PAUP 3.1.1 (Swofford 1993). Trees were
rooted using the same outgroup, Mytilaria laosensis Lecompte,
as in the previous study (Li et al. 1997a), except that Exbucklan-
dia R. W. Br., which is closely related to Mytilaria (Li et al.
unpubl.), was used for the GBSS data set because we were unable
to amplify the GBSS gene for Mytilaria due to its genomic DNA
deterioration. Decay analysis (Donoghue et al. 1992) and 1000
bootstrap replicates (Felsenstein 1985) were carried out to indi-
cate the relative support for the clades. Characters were unordered
and unweighted, and gaps were treated as missing data.

The ITS data contained 82 variable sites, 15 of which were
phylogenetically informative. The interspecific divergences be-
tween Liquidambar species ranged from 0.9-6.6%. A single most
parsimonious tree was generated based on the ITS data set with
a consistency index of 0.99. The tree was comprised of two
clades, one of which contained L. acalycina and L. formosana
and was supported by a bootstrap percentage of 100% and a de-
cay index of nine steps. The other clade was composed of L.
orientalis and L. styraciflua and was not strongly supported, with
bootstrap and decay values of 69% and one step, respectively.

1999] Note 89

L. acalycina
100
18
oamanaemn L. formosana
100
© >30
L. orientalis
86 4 7 yw
3 Vv AA

EH L. styraciflua

«JTS x -- matK 0 -- trnL intron --GBSS___OGS -- outgroups

Figure 1. The single most parsimonious tree of 535 steps of Liquidambar
based on sequences of ITS, matK, GBSS, and trnL intron. CI = 0.98. Num-

bers above and below the branches are bootstrap percentages and decay index
values, respectively. Symbols represent unambiguous, potentially informative
changes of each data set along the branches.

The trnL intron data set had 21 variable sites, two of which
were phylogenetically informative. The sequence divergences be-
tween Liquidambar species were from 0—0.8%. Liquidambar
acalycina and L. formosana had identical trnL intron sequences.
The parsimony analysis generated two equally short trees, one of
which showed the tree topology produced by the ITS data, while
the other tree did not resolve the relationships of L. formosana,
L. acalycina, and the clade of L. orientalis and L. styraciflua. The
consistency index was 1.0.

There were 105 variable sites in the GBSS data set, 15 of which
were informative. Parsimony analysis resulted in one single short-
est tree of 111 steps, with a consistency index of 0.96. In the

90 Rhodora [Vol. 101

phylogenetic tree, eight and seven informative sites supported the
clade of Liguidambar orientalis—L. styraciflua and L. acalycina—
L. formosana, respectively. Bootstrap values for the two clades
were 78% and 82%, respectively.

The four data sets were congruent, including matK, ITS, trnL
intron, and GBSS, and the combination of them created a data set

164 characters. The parsimony analysis, using both Zxbuck-
landia and Mytilaria as outgroups with Mytilaria GBSS sequenc-
es coded as missing data, produced a single most parsimonious
tree with a consistency index of 0.98. The gE tree
showed the same species relationships as described in al
(1997a). Both bootstrap percentages and decay values were high,
100% and 18 steps for the L. acalycina—L. formosana clade, and
86% and three steps for the clade of L. orientalis and L. styra-
ciflua. Figure 1 shows the number of unambiguous changes from
each of the four data sets that support the two clades.

This follow-up study strongly substantiates the previous hy-
pothesis that the western Asian species Liguidambar orientalis is
more closely related to the New World species L. styraciflua than
to the southeast Asian species. Additionally, we conclude that
sequences of the GBSS gene, especially the introns, provide an-
other informative nuclear marker (besides nrDNA ITS) in resolv-
ing phylogenetic relationships among closely related species.

ACKNOWLEDGMENTS. We thank Robie Mason-Gamer and Toby
Kellogg for assistance in designing GBSS gene primers. This
study was partially supported by a Putnam Postdoctoral Fellow-
ship through the Arnold Arboretum of Harvard University to JL.

LITERATURE CITED

BaALDwiINn, B. G., M. J. SANDERSON, J. M. Porter, M. FE WOIJCIECHOWSKI, AND
- J. DONOGHUE. 1995. The ITS region of nuclear ribosomal DNA: A
valuable apt > evidence on angiosperm phylogeny. Ann. Missouri
Bot. Gard. 82: ce
BocLe, A. L. 1986. pee floral morphology and vascular anatomy of the Ha-
mamelidaceae: Subfamily Liquidambaroideae. Ann. Missouri Bot. Gard.
73: 325-347.

Dat, W., W. DENG, W. Cul, S. ZHAO, AND X. WANG. 1996. Molecular cloning
and sequence of potato granule-bound starch synthase gene. Acta Bot.
Sin. 38: 777-784.

DonoGuHuE, M. J., R. G. OLMsTEAD, J. E Smitu, and J. D. PALMER. 1992.

1999] Note 91

Phylogenetic relationships of Dipsacales based on rbcL sequences. Ann.
Missouri Bot. Gard. 79: 333-345

FELSENSTEIN, J. 1985. Confidence limits on phylogeny: An approach using

the bootstrap. Evolution hy 783-791.

Hoey, M. T. AND C. R. Parks. 1991. Isozyme divergence between eastern
Asian, North American, Cid Turkish species of Liguidambar (Hama-
ae Amer. J. Pos 78: 938-947.

Li, J., A. L. BOGLE, AND A. S. KLEIN. 1997a. Interspecific SRT and
genetic divergence of the disjunct genus Liqguidambar (Hamamelidaceae)
inferred from DNA sequences of plastid gene matK. Shindinn’ 99: 229-

——-, AND 997b. Phylogenetic relationships in the Cor-
ylopss —— (Hamamelidaceae): Evidence from sequences of the in-
bed spacers of nuclear ribosomal DNA and morphology.
Rhodora 99. 302 318

AND K. PAN. 1997c. Close relationship between

Shandpdeniivon and Parone (Hamamelidaceae), evidence from ITS se-

quences of nuclear ribosomal DNA. Acta Phytotax. Sin. 35: 481—493.
SworFForD, D. L. 1993. PAUP: Phylogenetic Analysis Using Parsimony, ver-

sion 3.1.1. AOE ts of Molecular Systematics, Smithsonian Institu-

tion, Washington,
Peer, P, L. GrELty, fi PauTOu, AND J. Bouvet. 1991. Universal primers
for amplification of three non-coding regions of chloroplast DNA. PI.

Molec. Biol. 17: 1105—1109.

RHODORA, Vol. 101, No. 905, pp. 92-94, 1999
BOOK REVIEW

The Savage Garden: Cultivating Carnivorous Plants by Peter

"Amato. 1998. xxii + 314 pp. more than 200 photographs

and illustrations, most in color. ISBN 0-89815-915-6 $19.95
(paperback). Ten Speed Press, Berkeley, CA.

Carnivorous plants, a group of about 500 species and numerous
cultivars, have captivated botanists, horticulturalists, and students
of all ages since Darwin (1875) wrote one of the earliest books
on the group. The more easily grown species and those locally
abundant in boggy areas have been widely employed by teachers
to stimulate interest in young students in plant biology and ecol-
ogy. Unfortunately, until recently, little information has been
available in book form in public and college libraries for teachers
and students who want to know more about growing these plants.
In recent years, three books with a worldwide scope have been
published and widely distributed: Pietropaolo and Pietropaolo
(1986), Lecoufle (1989, in translation), and Cheers (1992). These
three works cover some of the same ground as the earlier and
excellent books by Slack (1980, 1988) which are difficult to ob-
tain.

Peter D’Amato’s book surpasses these earlier works in the
sheer volume of cultivation information and lore provided for
individual species and cultivars. It is based on Peter’s many years
of experience with growing these plants; of selling them through
his greenhouse, mail order and Internet nursery, California Car-
nivores; and of making numerous presentations at schools, hob-
byist meetings, and on television. His goal, as he described it
during a talk at the first meeting of the International Carnivorous
Plant Society in Atlanta in 1997, was to popularize the plants and
show how they can be grown in a wide variety of ways indoors
and out. The range of creative, and sometimes whimsical, ways
to grow these plants, well illustrated and described in the book,
is its strongest feature. Since the book covers species worldwide,
it also provides a starting point for exploring plant diversity and
plant geography. The amazing radiation of Drosera species in
Australia, and the narrowly restricted endemic genera Darling-
tonia, Heliamphora, and Cephalotus which use trapping mecha-
nisms similar to Sarracenia and Nepenthes are good examples.

1999] Book Review 93

A few minor faults should be noted. Many of the color pho-
tographs are small, but this allows for more text to flow around
the figures creating a tighter integration of the two. On the other
hand, this design foregoes including any large in situ shots such
as those in Schnell’s (1976) Carnivorous Plants of the United
States and Canada or Clarke’s (1997) truly stunning book on the
Nepenthes of Borneo. As noted in the review published in the
September (1998) issue of the Carnivorous Plant Newsletter,
there are some spelling errors and some of the cultivars listed are
not well documented in the literature. Readers interested in an
overview of the unique physiological and ultrastructural features
of carnivorous plants may wish to supplement this book with the
earlier work by Juniper et al. (1989). Some of the guidelines
presented for growing individual species may be less effective
outside the northern California climate where the author lives.
Apparently, no hardcover edition is available.

Overall, the well named Savage Garden is a bargain for the
wealth of information it contains. As a CP enthusiast, I use it
often. It may well achieve “‘bible’’ status for growers of these
plants, especially as tissue culture (described in the first Appendix
by expert Rob Gagliardo) makes more species available to the
general public. I would recommend this book for all libraries, and
to botanists and horticulturalists as a one-book gateway to know-
ing more about these fascinating plants.

LITERATURE CITED

Cueers, G. 1992. A Guide to the ‘nail Plants of the World.
HarperCollins Publishers, New Yor

CLARKE, C. 1997. Nepenthes of a Natural History Publications, Kota
Kinabulu, Sabah, Malaysia

Darwin, C. 1875. fanectiocninns Plants. John Murray Publishers, London.

JuNIPER, B. E., R. J. RoBins, AND D. M. JoEL. 1989. The Carnivorous Plants.
Academic Press, London.

LECOUFLE, M. 1989. Carnivorous Plants: Care and Cultivation. Cassell Vil-
liers House, London. (English translation.)

MEyYERS-RICE, B. 1998. Book review. Carniv. Pl. Newslett. 27: 72-7

rete J. AND P. eas 1986. ease etsivit Plants of the World.

mber Press, Portland, O

Papers D. E. 1976. hae Plants of the United States and Canada.

John E Blair Publisher, Winston-Salem, NC.

94 Rhodora [Vol. 101

SLack, A. 1980. Carnivorous Plants. MIT Press, Cambridge, MA.
—. 1988. Insect-Eating Plants and How to Grow Them. University of
Washington Press, Seattle, WA.

—DAvID LANE, Biological Sciences Library, Kendall Hall, Uni-
versity of New Hampshire, 129 Main St., Durham, NH 03824-
3590.

RHODORA, Vol. 101, No. 905, pp. 95-100, 1999
NEBC MEETING NEWS

October 1998. Dr. Lisa A. Standley, the Club’s Vice President,
spoke on the topic ‘‘Beyond the Brooks Range—Flora and Fauna
of the Arctic National Wildlife Refuge.’”” Among Dr. Standley’s
many activities, we learned, is participating in Sierra Club out-
ings. Twice in recent years, she has enjoyed ten-day backpacking
trips to the Arctic National Wildlife Refuge in northeastern Alas-
ka. Both trips were in mid-June, and started with a flight into
Fairbanks and transfer to a smaller plane that flew through passes
in the Brooks Range to the Romanzof Mountains and the coastal
plain of the Beaufort Sea, a couple of hundred miles north of the
Arctic Circle. The area hiked was between two rivers, the Jago
and the Aichilik, which flow northward from the mountains,
crossing the coastal plain to the sea. The Refuge is contiguous
with Indian lands and National Parks, which add to the wilderness
landscape. It is home to the caribou’s Porcupine Herd calving
grounds and their migration routes to the mountains. Fortunately
for us, Lisa was armed with a good camera and the ability to use
it well. We were treated to excellent images of the region’s plant
life, interspersed with those of the often present and possibly
curious caribou. Also, landscape shots illustrated some of the Ref-
uge’s varied habitats and unadulterated beauty. The hiking area
ranged in elevation from near sea-level to around 5000 ft. Most
of the landscape is devoid of tall trees, although some of the
narrower valleys supported white and black spruce in sheltered
areas. Low willows were the more typical woody vegetation. The
narrow valleys generally run east-west while larger river valleys
run north-south. Precipitation is surprisingly low there, with only
about 10 inches per year, Standley said. The few glaciers seen
while crossing the Brooks Range were relatively small and not
growing, evidently remnants of earlier times with higher rates of
precipitation.

The slide images gave a good sampling of the dominant plant
families in the Refuge and the Arctic region, in general. The
Cyperaceae, a family Standley knows especially well because of
her research on the genus Carex, is one of them. Sedges were
well represented and tipsy tussocks of cottongrass were frequently
underfoot. More frustrating for Lisa than the tipsy tussocks, per-
haps, was that nearly all the sedges present in June were flowering
rather than fruiting, making identification very challenging. An-

96 Rhodora [Vol. 101

other family well represented was the Salicaceae. A favorite for
Standley was Salix minima which stood less than an inch tall
with catkins of reddish flowers. The Saxifrage family was rep-
resented by several species of Saxifraga including S. oppositifol-
ia, a circumboreal species present in New England, and the very
unusual S. eschscholtzii with its tiny cushion-like rosettes of suc-
culent leaves only 2 mm across. Jumping to the Rose family, we
saw Potentilla hypartica (or P. nana, in some books), a close
relative of New England’s federally endangered P. robbinsiana.
Also representing the Rosaceae were both species of Dryas. The
hikers liked seeing Dryas, since it meant they would be walking
on gravel substrate and not wobbly tussocks. Ericads were also
represented in the tundra by white flowering Cassiope [or Har-
rimanella in some references], pink flowered Rhododendron lap-
ponicum described by Standley as weedy everywhere, and Loise-
leuria seen at around 5000 ft. elevation.

Also illustrated by Standley were: a Douglasia species (Pri-
mulaceae) which is endemic to Alaska and the Yukon; a Hedy-
sarum (Fabaceae) which has aromatic, edible roots eaten by griz-
zly bears; yellow poppies, which trap heat and attract flies in cup-
like flowers that tilt toward the sun, which in June’s solstice sky
shines for 24 hours per day; nitrophilous, orange-colored lichens
growing on rocks where birds perch; caribou trails made in the
tundra in the 1940s; caribou skeletons used for drying wet socks;
musk-oxen simulating “fringed sofas” swaying in the breeze; ae-
rial views of river meanders revealing a hundred or more years
of geomorphology; vertical Jurassic formations with marine fos-
sils; cliffs with gyrfalcon nest sites: sloping bogs at 4000-5000
ft.; and a grizzly sow with cub.

Standley recommended Pielou’s Arctic Naturalist and Birds of

laska.

1999] NEBC Meeting News 97

nine sample sites within a continuous, unfragmented habitat of
the Presidential Range in the White Mountains of New Hamp-
shire. Previous studies on the effects of fragmentation on loss of
genetic diversity, he said, have involved habitats with a relatively
recent history of fragmentation (i.e., less than a few hundred
years) and only one taxon. He thought, by examining high peak
populations presumably separated for thousands of years, that the
effects of time on genetic drift and genetic diversity might be
more apparent. By examining three species, he hoped to reduce
the possibility of any erroneous conclusions made by assuming
that what is true for one is true for all. Lindwall identified the
three key questions he wanted to answer in the study as: 1) Do
fragmented plant populations in the Adirondack peaks have less
diversity than the continuous population in the White Mountains?
2) Is there more gene flow in the Presidential Range than among
the fragmented populations in the Adirondacks? 3) What effect
does greater habitat area have on diversity in the White Moun-
tains versus the smaller area for each of the isolated Adirondack
sites?

A fortuitous coincidence of Lindwall’s site design, he added,
was that the overall land area and distances between sites for the
two study areas were approximately the same. To quantify the
relative abundance and frequency of each species, 6000 plots,
each one m2, were examined. The genetic diversity was assessed
using allozyme analysis. The three species studied were Minuar-
tia groenlandica, which appears to be exploiting disturbed trail-
edge habitat, Carex bigelowii, which forms large patches in the
White Mountains, and Diapensia lapponica, a monotypic genus
found in tundra. Three thousand tissue samples were taken and
analyzed during the study.

For each ines Lindwall’s three questions, the answers were
‘“‘ves,”” “no,” and “‘maybe.’’ Did the fragmented Adirondacks
have lower genetic diversity? For Diapensia lapponica, the an-
swer was a Statistically significant “tyes,” but for Minuartia
groenlandica, he found higher diversity at all Adirondack peak
sites than at the Presidential Range subsites. The results for Carex
bigelowii were not as easy to interpret. The overall genetic var-
iability was higher in the White Mountains, but because C. bi-
gelowii is less abundant in the Adirondacks than the Presidential
Range, the sample size was small and only one of four indices
was higher, statistically. Thus, we have a “‘maybe.”” What about

98 Rhodora [Vol. 101

gene flow? Lindwall created dendrograms to illustrate degrees of
similarity (or difference) in both genetics and geographic dis-
tances among the populations. Comparing Nei’s index of genetic
identity for each of the three species relative to the Adirondacks
and Presidentials, the answers were again mixed. For C. bigelo-
wii, there was a close relationship among all sites in New Hamp-
shire but not so among the New York sites. Minuartia groenlan-
dica, on the other hand, showed no particular pattern with gen-
erally good gene flow across the board. However, the most ge-
netically distant population in the Adirondacks was from the most
distantly isolated peak, the Gothics. The story with D. lapponica
also seemed to relate to distance between sites. In both areas there
appeared to be good gene flow with near neighbors, such as
among the four McIntyre Ridge peaks in the Adirondacks, but
less so when distance was greater between sites. What role does
habitat area play? With C. bigelowii, there was a clear relation-
ship: bigger places had more variability. Just the Opposite was
true for Minuartia: the smaller sites in the Adirondacks had sta-
tistically higher variability than the continuous population in the
Presidentials. For Diapensia, size appeared to have no effect, and
thus we have a “‘maybe”’ answer.

There was one general conclusion that fit all three species,
Lindwall said in summary: The greatest amount of genetic di-
versity occurs where each species is the most abundant. He also
concluded that we should neither assume that species will behave
the same despite similar histories, nor for conservation planning
purposes assume that the largest habitat area will support the most
diverse population of a given species.

December 1998. The program, entitled “Verdant Venues and
Ventures: Visible and Verbal Visions” represented the annual
event where Club members are invited to make short presenta-
tions on their explorations over the year. Keith Williams led off
with images from a South America vacation trip with his wife in
May. It was the middle of the dry season in Brazil, their first
destination, but they still saw lots of water because much of their
time was spent on the coast and in the Pantanal, a huge wetland
that extends into two other South American countries. Plants fea-
tured in the slide images were Tabebuia alba, an endangered tree
species in Brazil; Cuphea melvilla, a prolific shrub along the Pan-
tanal waterways; and Ludwigia inclinata and Cabomba furcata

1999] NEBC Meeting News 99

growing in sloughs and shallows of the Pantanal. He ended with
shots from Peru’s Inca Trail to Machu Picchu and an image of
an Equisetum growing from the mortar of stone ruins.

Marsha Salett followed Keith with a brief introduction to her
Master’s degree project at the University of Massachusetts—Bos-
ton which is to create a CD-ROM version of a natural history
guide to bogs of southern New England. She showed images of
several bogs with public access that she might feature in the
guide, as well as a few that lack easy access or boardwalks that
she may omit. Her intent is to present explanations and illustra-
tions of bog types and common species such as Kalmia angus-
tifolia and Ledum groenlandicum. Dichotomous keys and images
of plants in flower and fruit will be provided to help with iden-
tifications.

Lois Somers then took us back to the tropics with images of a
trip with husband Paul to Costa Rica. Being a registered nurse,
not a botanist, she used a few wildlife images to illustrate some
of the critters botanists need to be on the watch for while probing
the greenery. The images included an orange-kneed tarantula seen
in the Monteverde cloud forest and an eyelash viper seen at Brau-
lio Carrillo National Park. Aquatic critters to be aware of included
caiman seen on the Cano Negro River near the Nicaraguan border
and the much larger and fiercer crocodiles of the Palo Verde re-
gion.

Joanne Sharpe’s slides started in Costa Rica with an image of
Danaea wendlandii, one of the fern species she studied there for
six years. She then took us to Puerto Rico for a look at distur-
bance studies of ferns in a palm forest before and after Hurricane
Georges, and in mangrove swamps, where the 14 ft. tall leather
fern, Acrostichum danaeifolium, was regenerating following four
years of hydrologic disturbance from dike construction. Her last
stop was Maine with images from the Coastal Maine Botanical
Gardens in Boothbay, where Nyssa sylvatica can be found at or
near its northern limit.

David Hunt continued the regional theme with images from
New York where he has been helping to refine the state’s plant
community classification, particularly in the Northern Appala-
chian Ecoregion. His images included riverside ice meadows with
Prunus pumila and Andropogon gerardii and pine-dominated
rocky summit communities with either pitch or red pine and as-
sociates such as Vaccinium myrtilloides, Amelanchier bartrami-

100 Rhodora [Vol. 101

ana, and Oryzopsis pungens. He then took us underwater at Lake
George where he has been doing underwater vegetation sampling
at depths up to 40 ft. In shallow bays he found Potamogeton
amplifolius—Vallisneria americana and Eriocaulon aquaticum—
Elatine americana to be common community types, whereas
sandy deltas had associations of Lobelia dortmanna and Myrio-
phyllum pinnatum. In deeper waters he found associations of Na-
jas flexilis, Potamogeton gramineus, and P. perfoliatus. At 30 ft.,
he found beds of Jsoetes macrospora and Potamogeton robbinsii,
and at 40 ft., a dense cover of Nitella flexilis. With this success,
he’s now tackling marine eelgrass environments of Long Island.

The next three presenters came as a team representing the new-

formed Botanical Club of Cape Cod and the Islands. Don
Schall spoke about the group’s search for and likely rediscovery
of an extant population of Asclepias purpurascens on the Cape
and the discovery of water hyacinth, Eichhornia crassipes, thriv-
ing in a spring upwelling near a Barnstable cranberry bog. Mario
DiGregorio discussed, with a vial sample in hand, the group’s
discovery of a county record for Wolffia papulifera from a fresh-
water pond in Barnstable and showed images of sandplain grass-
land rarities: Liatris scariosa var. novae-angliae being visited by
a monarch butterfly, Aster concolor at the northern limit of its
range, Aristida purpurascens, New England’s only perennial awn-
grass, and Prenanthes serpentaria from Nantucket. Pamela Pol-
loni continued with the discussion of P. serpentaria by pointing
out its hairy calyx, which distinguishes it from P. trifoliata, and
other aspects of its life history such as pollination by Bombus
bees and how to recognize the juvenile plants.

—PauL Somers, Recording Secretary.

INFORMATION FOR CONTRIBUTORS TO RHODORA

Submission of a manuscript implies it is not being considered for
publication simultaneously elsewhere, either in whole or in part.

GENERAL: Manuscripts should be submitted in triplicate. The text
must be double-spaced throughout, including tables, figure legends,
and literature citations. Use a non-proportional font throughout and
do not justify the right margin. Do not indicate the style of type
through the use of capitals, underscoring, or bold, except for names
of genera and species which should be in italics or underscored
throughout. Do not underline punctuation. All pages should be num-
bered in the upper right-hand corner. For guidance in matters not
addressed here, consult the editorial office by phone at (603) 862-
3205, FAX (603) 862-4757, or e-mail: janets@christa.unh.edu. Brev-
ity is urged for all submissions. Submit manuscripts to the Editor-in-
Chief.

TITLE, AUTHOR(S), AND ADDRESS(ES): Center title, in capital
letters. Omit authors of scientific names. Below title, include au-
thor(s) name(s), affiliation(s), and address(es). If “‘current address”
is different, it should follow immediately below, not as a footnote.

ABSTRACT: An abstract and a list of key words should be included
with each paper, except for shorter papers submitted as Notes. An
abstract must be one paragraph, and should not include literature
citations or taxonomic authorities. Please be concise, while including
information about the paper’s intent, materials and methods, results,
and significance of findings.

TEXT: Main headings are all capital letters and centered on one line.
Examples are: MATERIALS AND METHODS, RESULTS, and DIS-
CUSSION. Do not title the Introduction. Do not combine sections of
the paper (such as Results and Discussion), or use Conclusions or
Summary. Second level headings should be indented, bold, upper and
lower case, and end with a period. Taxonomic authorities should be
cited for all species names at their first usage in the text, or in a
referenced table. Cite each figure and table in the text in numerical
order. Each reference cited in the text must be in the Literature Cited.
Cross-check spelling of author(s) name(s) and dates of publication.
Literature citations in the text should be as follows: Hill (1982) or
(Hill 1982). For two or more authors, cite as follows: Angelo and
Boufford (1996) or (Angelo and Boufford 1996). Cite several refer-
ences alphabetically by first author, rather than chronologically. With-
in parentheses, use a semicolon to separate different types of citations
(Hill 1982; Angelo and Boufford 1996) or (Figure 4; Table 2).

FLORAS AND TAXONOMIC TREATMENTS: Specimen citation
should be selected critically, especially for common species of broad

101

102 INFORMATION FOR CONTRIBUTORS

distribution. Keys and synonymy for systematic revisions should be
prepared in the style of ‘““A Monograph of the Genus Malvastrum,”
S. R. Hill, RHODORA 84: 159-264, 1982. Designation of a new
taxon should carry a Latin diagnosis (rather than a full Latin descrip-
tion), which sets forth succinctly how the new taxon differs from its
congeners.

LITERATURE CITED: All bibliographic entries must be cited in the
paper, unless a special exception has been made by the Editor (such
papers will be allowed a REFERENCES section). Verify all entries
against original sources, paying special attention to spelling and de-
tails of publication. Cite references in strict alphabetical order by first
author’s surname. Do not write authors’ names in all capital letters.
References by a single author precede multi-authored works of same
senior author, regardless of date. Use a long dash when the author(s)
is the same as in the entry immediately preceding (see recent issues).
Refer to Botanico-Periodicum-Huntianum (B-P-H 1968) and B-P-H/
Supplement (1991) for standardized abbreviations for journals.

TABLES: Tables must be double-spaced. Tables may be continued
on an extra page, if necessary. As much as possible, the title should
be self-explanatory. Do not use footnotes; instead, add notes after
the end of the table title. Broadside tables should be avoided, if pos-
sible. Each table should be cited in the text in numerical order.

URES: Illustrations must be either black and white half-tones
(photographs), drawings, or graphs. Illustrations must be camera-
ready; flaws cannot be corrected by the Editor or the printer. Add
symbols or shading with press-on sheets. The printed plate will be
4 X 6 inches; be sure that illustrations are proportioned to reduce
correctly. Allow space for a caption, if possible. Magnification/re-
duction values should be calculated to reflect the actual printed size.
Maps must indicate scale and compass direction. The double-spaced
list of legends for figures should be provided on a separate page.
Each figure should be cited in the text in numerical order.

THE NEW ENGLAND BOTANICAL CLUB
22 Divinity Avenue
Cambridge, MA 02138

The New England Botanical Club is a nonprofit organization
that promotes the study of plants of North America, especially
the flora of New England and adjacent areas. The Club holds
regular meetings, and has a large herbarium of New England
plants and a library. It publishes a quarterly journal, RHO-
DORA, which is now in its 101st year and contains about 400
pages per volume. Visit our web site at http://www.herbaria.
harvard.edu/nebc/

Membership is open to all persons interested in systematics
and field botany. Annual dues are $35.00, including a subscrip-
tion to RHODORA. Members living within about 200 miles of
Boston receive notices of the Club meetings.

To join, please fill out this membership application and send
with enclosed dues to the above address.

Regular Member $35.00
Family Rate $45.00
Student Member $25.00

For this calendar year
For the next calendar year ee

Name

Address

City & State Zip

Phone FAX

Special interests (optional):

Ann a ing

3 1 753 00364 9

THE NEW ENGLAND BOTANICAL CLUB

Elected Officers and Council Members for 1998-1999:

President: David S. Conant, Department of Natural Sciences,
yndon State College, Lyndonville, VT 05851

Vice-President (and Program Chair): Lisa A. Standley, Vanasse
Hangen Brustlin, Inc., 101 Walnut St., PO. Box 9151, Wa-
tertown, MA 02272

Corresponding Secretary: Nancy M. Eyster-Smith, Department
of Natural Sciences, Bentley College, Waltham, MA 02154-
4705

Treasurer: Harold G. Brotzman, Box 9092, Department of Bi-
ology, Massachusetts College of Liberal Arts, North Adams,
MA 01247-4100
Recording Secretary: Paul Somers
Curator of Vascular Plants: Raymond Angelo
Assistant Curator of Vascular Plants: Pamela B. Weatherbee
Curator of Nonvascular Plants: Anna M. Reid
Librarian: Leslie J. Mehrhoff
Councillors: W. Donald Hudson, Jr. (Past President)
Michael J. Donoghue 1999
Arthur V. Gilman 2000
Karen B. Searcy 2001
Matthew Hickler (Graduate Student Member) 1999

Appointed Councillors:
David E. Boufford, Associate Curator
Janet R. Sullivan, Editor-in-Chief, Rhodora

Journal of the
New England Botanical Club

CONTENTS

Inventory and vegetation classification of floodplain forest communities in
M

chusetts. Jennifer B. Kearsley 105
Jaltomata lojae (Solanaceae): Description and floral — of a new An-
ean species. Thomas Mione and Luis A. Seraz 136
The reproductive biology of Magnolia evn Larry K. Allain, Mi-
Zavada, and Douglas G. Matth 143
The taxonomy of Carex section Scirpinae (Cyperaceae). Debra A. Dunlop
and Garrett E. Crow 163
NEW ENGLAND NOTE
Rare and non-native plants of Massachusetts’ floodplain forests. Jennifer
Kearsley 200
BOOK REVIEW
Wild Orchids Across North America: A Botanical Travelogue .......... 206
NEBC MEETING NEWS 208
Information for Contributors 213
NEBC Membership Form 215
NEBC Officers and Council Members inside back cover
MISSOURI BOTANICAL
JUL 1 3 1999
GARDEN LIBRARY
Vol. 101 Spring, 1999 No. 906

Issued: June 29, 1999

The New England Botanical Club, Inc.

22 Divinity Avenue, Cambridge, Massachusetts 02138

RHODORA

JANET R. SULLIVAN, Editor-in-Chief

Department of Plant Biology, University of New Hampshire,
Durham, NH 03824

ANTOINETTE P. HARTGERINK, Managing Editor

Department of Plant Biology, University of New Hampshire,
Durham, NH 03824

Associate Editors

HAROLD G. BROTZMAN STEVEN R. HILL
DAVID S. CONANT THOMAS D. LEE
GARRETT E. CROW THOMAS MIONE

K. N. GANDHI—Latin diagnoses and nomenclature

ACCREDITED with the International Association for Plant Taxonomy
for the purpose of registration of new names of vascular plants (ex-
cluding fossils).

SUBSCRIPTIONS: $75 per calendar year, net, postpaid, in funds paya-
ble at par in United States currency. Remittances payable to RHO-
DORA. Send to RHODORA, PO. Box 1897, Lawrence, KS 66044-
8897.

MEMBERSHIPS: Regular $35; Family $45; Student $25. Application

form printed herein

ADDRESS CHANGES: In order to receive the next number of RHO-
DORA, changes must be received by the business office prior to the
first day of January, April, July, or October.

RHODORA, Vol. 101, No. 906, pp. 105-135, 1999

INVENTORY AND VEGETATION CLASSIFICATION OF
FLOODPLAIN FOREST COMMUNITIES IN Missoury BOTANICAL
MASSACHUSETTS

JENNIFER B. KEARSLEY JUL 0 . 1999

Massachusetts Natural Heritage & Endangered Species Program,
Massachusetts Division of Fisheries & aa Route 13.BARDEN LIBRARY
Westborough, MA 015

ABSTRACT. Floodplain forests on eleven rivers in Massachusetts were sur-
veyed to determine the variation in vegetation and soils across a range of
hydrologic, physiographic, and climatic conditions. Quantitative vegetation
data collected from 124 plots at 43 sites were analyzed using SPAN
and DECORANA (DCA), and six community types were identified. The six

pes were: Type I—Riverine island floodplain forests (Acer saccharinum—
Populus deltoides-Acer negundo—Matteuccia struthiopteris association);

Type II—Major-river floodplain forests (A. saccharinum—P. deltoides—Lapor-
tea canadensis association); Type I1I—Transitional floodplain forests (A. sac-
charinum—Arisaema dracontium association); Type [V—Small-river flood-
plain forests (A. saccharinum—Fraxinus pennsylvanica—Quercus palustris as-
sociation); Type V—Alluvial swamp forests (Acer rubrum—A. saccharinum—
Q. bicolor association); and 1 VI—Alluvial terrace forests (A. rubrum—

densis, Boehmeria cylindrica, and Onoclea sensibilis. Results of the classi-

rang: showed variation in floodplain forest vegetation composition among
ers in Massachusetts corresponding to significant differences in soil mot-

da soil texture, presence/absence of a surface organic layer, and soil pH.

Key Words: Acer saccharinum, community classification, DECORANA,
floodplain forest, Massachusetts, ordination, TWINSPAN

Floodplain forests, which develop on alluvial mineral soils
within the zone of active flooding of rivers and streams, are con-
sidered to be among the most threatened, globally significant wet-
land community types in New England. Due to their high soil
fertility and scenic qualities, floodplain forests have largely been
converted to agriculture or lost to housing and industrial devel-
opment. While several studies have addressed the relationship
between floodplain forest vegetation and environmental variables
within a single site or river basin in New England (Metzler and

amman 1985; Veneman and Tiner 1990), this study addresses
the variability in floodplain forest vegetation and environments
across river basins and physiographic regions. The objectives of

105

106 Rhodora [Vol. 101

the current study were to conduct a statewide vegetation classi-
fication of floodplain forest communities, to determine the distri-
bution of defined community types across drainage basins and
rivers, and to assess differences in environmental parameters
among the identified floodplain forest community types.

The Massachusetts inventory and classification work is part of
a regional effort to classify floodplain forests by state Natural
Heritage Programs and The Nature Conservancy. Results of these
projects will provide the baseline community data necessary for
future in-depth studies of floodplain forest communities, and for
land protection and conservation of these ecologically significant
wetland communities.

MATERIALS AND METHODS

Site selection. Potential floodplain forest sites were identified
using USGS topographic quadrangles, Natural Resource Conser-
vation Service soil surveys, and color-infrared (CIR) aerial pho-
tography. A combination of 1:25,000 scale, leaf-on CIR aerial
photography from an unpublished community inventory of the
Connecticut River Valley (Motzkin 1993), and 1:12,000 scale,
leaf-off CIR aerial photography obtained from the Massachusetts
Department of Environmental Protection Wetlands Conservancy

ogram were used. Potential floodplain forest sites were identi-
fied using the following criteria: (1) low, forested sections of
greater than 3 ha occurring within 1—2 contour intervals (10—20
ft. elevation) of river’s edge; (2) presence of alluvial soils; and
(3) evidence of spring flooding and forest vegetation on aerial
photography. The Massachusetts Natural Heritage and Endan-
gered Species Program Biological and Conservation Database
was also used to locate potential floodplain forest sites by iden-
tifying localities of tracked, state-protected rare species known to
occur in floodplain forest habitats.

Using the resources and criteria listed above, 144 potential
floodplain forest sites were identified in the state. Based on pre-

Figure 1. Massachusetts’ rivers and sub-ecoregions with sites surveyed
for floodplain forest vegetation classification. Sub-ecoregions containing sur-
vey sites are shaded in grey.

SELECTED SUB-ECOREGIONS OF MASSACHUSETTS
A - Western New England Marble Valleys

B - Connecticut Valle

C - Southern New England Coastal Plains

D - Narragansett & Bristol Lowland

-_— — (5 9 «/

N River
A Ecoregion Boundary

/V Sub-ecoregion Boundary

ley Lo
.
“ Po)
' ri rn rn rs ta ym~ wa
ee mt m s
© 1 8 9 40 50 kilometers gl ‘ “s Pa AN
"Shececaaca™

[6661

SONMUNUIUIOD 1S910.J UTe[dpoo],j—Aoz]sieay

108 Rhodora [Vol. 101

Table 1. Drainage basins and river sections with sampled floodplain forest
communities. Tributaries refer to third order or smaller streams. 50% Ex-
ceedance values indicate the discharge of 50% of flows annually, averaged
over the period of record (Socolow et al. 1995). Exceedance values are given
in cubic feet per second (cfs).

Drainage 50% Num-
Basin Exceed- Num-_ ber
Area (sq. ance berof of

Basin River miles) (cfs) Sites Plots
Blackstone Blackstone 25.6 422 1 1
Connecticut Connecticut at 9,660 11,000 17 31

Connecticut tributaries — — 7 24

Deerfield 557 950 7 11

Housatonic Housatonic at 465 456 5 13

Ashley Falls, MA

Ipswich Ipswich 44.5 37 1 4
Merrimack Assabet 116 125 1 4
Concord 400 481 1 4

Merrimack 4,635 5,110 4 4

Nashua 435 365 2 43

Nashua tips — — 1 3

Shawshee 36.5 38 2, 6

Taunton SERIE 84.3 113 1 6
Totals 43 124

liminary field checks of potential sites, 55 were found to be
semi-natural forested floodplain sites with evidence of periodic
flooding (e.g. floodlines on trees, flood debris, or scoured sur-
faces) and a relative lack of evidence of human disturbance (e.g.
limited clearings or non-native plant species). Quantitative veg-
etation and environmental data were collected at 43 of the semi-
natural forested floodplain sites that were distributed across
eleven rivers and four physiographic provinces, or sub-ecore-
gions (Figure 1).

e eleven rivers ranged in drainage basin area from 25—
10,000 square miles, and in mean 50% exceedance values from
30—11,000 cubic feet per second (cfs; Table 1). Fifty percent ex-
ceedance values are used as indicators of average river discharge;
they indicate the minimum discharge in cfs that 50% of all flows
exceed annually, averaged over the period of record (Socolow et
al. 1995). Identified floodplain forest sites ranged in size from 1

1999] Kearsley—Floodplain Forest Communities 109

to 30 ha. Five sites less than the minimum size criterion of 3 ha
were included because they either occurred on state-owned land
with easy access (3 sites) or occurred on the Merrimack River 2
sites) where potential sampling sites were limited.

Study area. The eleven rivers sampled in this study are lo-
cated within four subregions of the two ecological regions, or
ecoregions, occurring in Massachusetts: the Northern Highlands
Ecoregion and the Northeastern Coastal Zone (Figure 1; Griffith
et al. 1994). These ecoregions are defined as areas with distinct
geology, landforms, soils, vegetation, climate, wildlife, water, and
human influences (Griffith et al. 1994).

The Northern Highlands Ecoregion includes all of Massachu-
setts west of the Connecticut River Valley and the Worcester Pla-
teau in north-central Massachusetts as well as most of northern
New England and the Adirondack Mountains in New York (Grif-
fith et al. 1994). It roughly corresponds to the Adirondack-New
England mixed forest-coniferous forest—alpine meadow province
described by Bailey (1995). The Northeastern Coastal Zone in-
cludes eastern and coastal Massachusetts, most of southern New
England, and coastal regions of New Hampshire and southern
Maine (Griffith et al. 1994). It falls within the central Appalachian
broadleaf forest—-coniferous forest-meadow province described by
Bailey (1995).

The lower Housatonic River runs through the Western New
England Marble Valleys subregion of the Northern Highlands
Ecoregion (Figure 1). Bedrock in this region, also known as the
Berkshire Valley, consists of calcitic and dolomitic marbles and
limestones; surface water alkalinity values in the area are high

1000 yeq/L; Griffith et al. 1994). The Connecticut and Deer-
field Rivers and the lower reaches of their tributaries are included
in the Connecticut Valley subregion of the Northeastern Coastal
Zone (Figure 1). The Connecticut Valley is characterized by thick
outwash, alluvial, and lake bottom deposits overlaying sedimen-
tary bedrock. Surface water alkalinity values are generally above
500 wed/L.

The Blackstone, Concord, Assabet, Merrimack, Shawsheen,
Ipswich, and Nashua Rivers occur within the Southern New Eng-
land Coastal Plains and Hills subregion (Figure 1). This is the
largest subregion in southern New England and is variable in its
topography and bedrock. Bedrock types in the subregion are

110 Rhodora [Vol. 101

mostly granites, schist, and gneiss, and surface water alkalinity
values are generally lower than in the Connecticut Valley, ranging
from less than 50 to 500 peq/L. The Threemile River occurs in
the Narragansett Bristol Lowland subregion (Figure 1). The Nar-
ragansett Basin is similar to the Coastal Plains and Hills subre-
gion, but bedrock outcrops are not common, and thick glacial till
and outwash deposits cover the area. Surface water alkalinity val-
ues are generally between 100 to 300 wedq/L, but several areas
have values less than 50 peq/L (Griffith et al. 1994).

Field methods. Vegetation was sampled in 10 m X 20 m
(0.02 ha) rectangular plots placed along transects perpendicular
to the river. At most sites, two or more transects were placed at
least 50 m apart. Each transect was walked and changes in to-

aphy and vegetation were described. A plot was placed with-
in each identified topographic or vegetation unit. In small flood-
plain forests (=3 ha), one or two plots were subjectively placed
within the “‘typical’’ vegetation type(s) and not along transects.
The number of plots per site ranged from 1 at small sites to 8 at
large sites.

Plots were placed with their long axis parallel to the river.
Percent cover of trees (stems >10 cm DBH), shrubs (stems <10
cm DBH), saplings, and vines was visually estimated within each
0.02 ha plot, and percent cover of herbs and seedlings was vi-
sually estimated within two 0.0004 ha (2 m X 2 m) square sub-
plots. Herbaceous taxa (<1 m tall) occurring within the 0.02 ha
plot, but not within the subplots, were also recorded. Nomencla-
ture follows Kartesz (1994). Percent cover for all taxa was esti-
mated using a modified Braun-Blanquet cover scale with the fol-
lowing cover classes: r (single occurrence), <1%, 1-5%, 6-10%,
11-20%, 21-25%, 26-35%, 36-45%, 46-50%, 51-55%, 56—
65%, 66-75%, 76-85%, 86-95%, and 96-100%. The average
height and average percent cover of each vegetation stratum were
also visually estimated and recorded.

Vegetation data from 124 plots were included in the vegetation
classification (Table 1). Eighty-nine plots were surveyed between
July and September, 1997, using the methods described above.
Existing data from 35 plots collected with equivalent methodol-
ogies by other sources were included in the vegetation classifi-
cation. Those data were: 10 plots from the Deerfield River
(Thompson and Jenkins 1992), 16 plots from the Nashua River

1999] Kearsley—Floodplain Forest Communities 111

(Searcy et al. 1993), 7 plots from the Connecticut River and its
tributaries (Motzkin 1993, 1995; Massachusetts Audubon Society,
unpubl. data), and 2 plots from the Ipswich River (Massachusetts
Audubon Society, unpubl. data).

Environmental data were collected from the 89 plots sampled
in 1997. At each plot, one 60 cm deep soil pit was dug and the
following soil characteristics were described: depth, soil texture,
and color of horizons; depth to mottling; color of mottles; depth
of root penetration; and average pH of the mineral soil. The fol-
lowing environmental data were also collected for each plot: to-
pographic position (terrace, levee, level floodplain, depression),
height of floodlines, and the number of stumps, and uprooted and
snapped trees. Any evidence of disturbance or land use was also
noted.

Data analysis. Vegetation cover data were analyzed using
two-way indicator species analysis (TWINSPAN) and ordination
techniques (DCA) contained in the PC-ORD Version 3.0 statis-
tical package (McCune and Mefford 1997). TWINSPAN (Hill
1979a) was used to identify floodplain forest types, and DCA
(Hill 1979b) was used to illustrate the relationship between types.
Default settings were used with the following exceptions: Braun-
Blanquet cut-levels (0, 5, 26, 51, and 76) were used in the TWIN-
SPAN analysis, and downweighting of rare species was used in
DCA. Community types were based on both TWINSPAN and
DCA results. Species indicator values for the community types
were calculated using the Indicator Species Method of Dufréne
and Legendre (1997) in the PC-ORD Version 3.0 statistical pack-
age (McCune and Mefford 1997). Indicator species defined by
the Indicator Species Method were used instead of TWINSPAN
indicator species to describe community types because: (1) final
community types were based on both TWINSPAN and DCA re-
sults, and (2) the Indicator Species Method defines indicator spe-
cies as those species present in the majority of sites belonging to
a group, while TWINSPAN defines them as those species that
are found mostly in a single group, but not necessarily in the
majority of that group’s sites (Dufréne and Legendre 1997). A
Monte Carlo technique was used to test for the statistical signif-
icance of indicator values.

Species richness, evenness (E), and Shannon diversity index
(H’) values were calculated for each plot using the method out-

112 Rhodora [Vol. 101

lined in the PC-ORD statistical package (McCune and Mefford
1997). Single factor analysis of variance (ANOVA) was used to
test if the indices were significantly different among community
types. A multi-response permutation procedure (MRPP; Zimmer-
man et al. 1985) was used to test if defined community types
differed significantly in height and total percent cover of the fol-
lowing six strata: emergent canopy, tree canopy, tree sub-canopy,
tall shrubs, short shrubs, and herbs.

In order to test for differences in soil characteristics among the
defined community types, an MRPP was run on the following
variables: presence/absence of soil mottling, depth to mottling
(cm), soil texture at 10 cm intervals (sand, loamy sand, sandy
loam, and silt loam), presence/absence of a surface organic layer,
depth of organic layer, pH, and presence/absence of hydric soil.
Hydric soil determination was based on the criteria outlined by
the Natural Resource Conservation Service (1994). Individual
ANOVA and chi-square tests were used to determine which soil
variables were significantly different (at p < 0.01) among defined
community types. Chi-square tests were used to test for signifi-
cant differences in presence/absence of floodlines and topograph-
ic position.

RESULTS

Vegetation classification. Six vegetation community types
were recognized based on the TWINSPAN (Figure 2) and DCA
(Figure 3) results. There was general agreement between TWIN-
SPAN groups and DCA output (Figure 3). The six community
types described below are primarily based on the TWINSPAN
output (Figure 2) with two exceptions. First, twelve plots classi-
fied as one type by the TWINSPAN analysis were moved to a
different community type based on the DCA results. For example,
TWINSPAN classified ten plots as Type I (Figure 2), but the
DCA results showed that two plots classified as Type II by
TWIN were more closely related to plots classified as Type
I. Therefore, Type I is described below as containing twelve plots,
and twelve plots were included in the environmental analyses.
The second exception is that four plots classified by TWINSPAN
were eliminated from the final community types described below
and from the environmental analyses because they were found to
be distinct species assemblages, unlike all other plots.

1999] Kearsley—Floodplain Forest Communities 113

MAST (3)

ARTR (1)

ULRU (1) TYPE I
MAST (1) 4
LACA (1) (N=10)

PODE (1) TYPE II
ACSA (4) (N=36)
LACA (1)
TYPE Il
(N=18)
TYPE IV
(N=28)
* BOCY (1)
Ae! All OSRE (1) peeee
(N=17)
VIDE (1)
ACRU (1)

CAOV (1)
ht), TYPE VI
(N=15)

Figure 2. TWINSPAN dendrogram of floodplain forest community types
with TWINSPAN indicator species listed at divisions. Species codes follow
those listed in Table 2. Numbers in parentheses next to each species indicate
the minimum percent cover class for that species in all plots within the com-
munity type: (1) 0-4%, (2) 5—25%, (3) 26-50%, (4) 51-75%. Sample sizes
refer to the number of plots classified as each type in the TWINSPAN anal-
ysis.

The primary division of plots in TWINSPAN was made based
on the occurrence of Acer saccharinum and A. rubrum with Types
I, II, II, and IV having A. saccharinum dominant in the overstory
and Types V and VI having A. rubrum dominant (Figure 2). Var-
iation in species composition across DCA ordination Axis 1 (R?
= 0.227) was also associated with a decrease in A. saccharinum
and increase in A. rubrum. Variation in species composition
across DCA Axis 2 (R? = 0.127) was associated with an increase
in Ulmus rubra and Impatiens pallida and a decrease in Populus
deltoides and Laportea canadensis. Axis 3 did not characterize
much additional variation in species composition (R2 = 0.038).
Plots of Types II and III were closely related in TWINSPAN

114 Rhodora [Vol. 101

400 5
Oy
300 4 key
oO
O Vv re
es - & :
5 200 - > uv + 9 A A
Oo V,
Bogen tries ¢ Boo
eae: a es de yan A s.
100 ee a! a. © m
ore) & A
O
0 5 A
0 100 200 300 400 500
Axis 1

Figure 3. First two axes of the floodplain forest DCA output with plots
coded by TWINSPAN group. Squares = Type I, circles = Type II, down-
facing triangles = Type III, pluses = Type IV; up-facing triangles = Type
V, and diamonds = Type VI.

clustering where they divided at the fourth division (Figure 2),
but they were well separated in the DCA analysis along both
Axes 1 and 2 (Figure 3).

Two hundred and fourteen vascular plant species were identi-
fied in the floodplain forest sampling. A subset of those species
with indicator values that were significant (p < 0.05) and/or
greater than 10% are listed in Table 2. Indicator values represent
a combination of species relative abundance and relative fre-
quency of occurrence in the identified community types (Dufréne
and Legendre 1997). For example, an indicator value of 10%
assumes that the species was present in at least 33% of sites in
a community type, and that the relative abundance of the species
was at least 33% in one of the community types. If one of the
two measures was 100% then the other was at least 10% (Dufréne
and Legendre 1997). Thirty-four taxa with indicator values great-
er than 20% were plotted according to their DCA axis loading
scores for Axis 1 and Axis 2 to illustrate the relationship between
species abundance and community types (Figure 4).

1999] Kearsley—Floodplain Forest Communities 115

RHTY
600 fe)
500
URSE
4 °
ULRU
400 a IMP/4O
1 MAST
ois 300 - vin
ye GECA = ARTR
< TO
LYUN
BOCY CAOV
200 4 PODE © dee © UVSE,
° 2 fe)
— Aku
7 © OSCI
CIAR MACA~ QBSA
° fo)
100 5 in QUBI IVSA
LYSU OSRE GvDGR
zt 9° fe) °
LEVI © L
0 LACA ° OAM
re} °o
-100 T T T T T

T ce fo ae
-100 0 100 200 ©6300 400 500 600
Axis 1
Figure 4. Floodplain forest species with indicator values that are >20%
and significant (p < 0.05) plotted by their axis loading scores for DCA Axis

Acer saccharinum was the most common tree species encoun-
tered and therefore had a low maximum indicator value (22%)
for any single community type (Table 2). Acer saccharinum at-
tained its highest indicator values in Types II (20%), III (20%),
and IV (22%). Ulmus rubra was a strong indicator species (46%)
for Type I, Populus deltoides for Types I and II (24% and 28%,
respectively), and A. rubrum and Carya ovata for Type VI (60%

and 49%, respectively; Table 2). Shrubs and saplings were im-
portant components of Types I, V, and VI: Berberis thunbergii,
Rhus typhina, and Rosa multiflora had high indicator values in
Type I floodplain forests; Cornus amomum and Rhamnus fran-
gula in Type V; and Ilex verticillata, Viburnum dentatum, and
Quercus bicolor seedlings in Type VI (Table 2: Figure 4).

Table 2.
species

Indicator values and associated p values for floodplain forest taxa listed by community type. * indicates non-native

Indicator Values by Community Type

Species Name CODE I II Il IV Vv VI p value
Acer saccharinum ACSA 10 20 20 22 14 1 0.035
TYPE I
Matteuccia struthiopteris MAST 61 10 1B 0 0 0 0
Imus rubra ULRU 46 3 0 0 0 0 0
Impatiens pallida IMPA 38 2 0 0 0 0 0
Arisaema triphyllum ARTR Sf 6 11 2 0 4 0
U. rubra seedling URSE 31 0 0 0 0 0 0
A. negundo sapling ANSA 25 1 0 0 0 0 0
Rhus - e ina RHTY 25 0 0 0 0 0 0
Vitis ri VIRI 25 1 7 0 0 0 0.017
eBarberis finbeet BETH 24 0 0 0 0 0 0.006
negundo seedlings ANSE 22 0 0 0 0) 0 0.001
*Rosa multifl ROMA 20 2 0 0 0 0 0.027
Geum canadense GECA 18 3 8 0 0 0 0.031
Acer negund ACNE 16 3 0 0 0 0 0.042
*Celastrus orbiculata CEOR 10 3 1 3 0 0 0.26
Eupatorium rugosum EURU 10 6 9 0 0 0 0.437
TYPE I
Laportea canadensis LACA 0 84 3 0 0 0
Leersia virginica LEVI 0 29 19 2 2 0 0.058
Populus deltoides PODE 24 28 1 0 0 0 0.001
Helianthus tuberosus HETU 0 15 0 0 0 0) 0.046

ee
—
On

eIOopoyy

IOI TOA]

Table 2. Continued.
Indicator Values by Community Type

Species Name CODE I II Ii IV Vv VI p value
*Glechoma hederacea GLHE i 14 1 0 0 0 0.214
*Chelindonium majus CHMA 0 13 0) 0 0 0 0.073
TYPE Il
Boehmeria cylindrica BOCY 0 l 32 24 20 0 0.013
Cinna arundi CIAR 0 2 a2 1 11 0 0.015
Onoclea sensibilis ONSE 1 0) PM 25 13 7, 0.013
Toxicodendron radicans TORA 0 1 25 9 18 Is 0.127
Amphicarpaea bracteata AMBR 0 Zz 24 l 0 0 0.002

ricana sapling UASA 0 zZ 20 0 0) 1 0.054
*Alliaria petiolata ALOF 0 2 18 0 0 0 0.054
Arisaema dracontium ARDR 0 0 16 0 0 0 0.011
Polygonum virginianum TOVI 1 2 16 0 0 0 0.026
F, americana sapling FASA 0 0 14 0 0 0 0.045

. Saccharinum sapling ASSA 2 4 13 3 1 0 0.21

Plena occidentalis PLOC 2 0 12 0 0 0 0.05
TYPE IV
A. saccharinum seedlings ASSE 0 I 0 39 8 0 0.001
Sium s SISU 0 0 0 29 0 0
*Lysimachia nummularia LYNU 0 0 0 2 0 0 0.026
F. pennsylvanica seedlings FPSE 9 0 0 20 0 0 0.016
Cephalanthus occidentalis CEOC 0 0 0 19 1 0 0.01

[6661

SOnIUNUWIWOD 3se10,j ule[dpoo,j—Aoysieay

Table 2. Continued.
Indicator Values by Community Type

Species Name CODE I Il Il IV Vv VI p value
Fraxinus pennsylvanica FRPE 0 0 1 19 6 1 0.039
Lysimachia terrestris EYTE 0 0 0 18 0 2 0.012
Quercus palustris QUPA 0 0 0 18 0 0 0.007
*Myosotis scorpioides MYSC 0 0 0 17 0 0 0.043
Cicuta maculata CIMA 0 0 0) 14 0) 0 0.035
Leersia oryzoides LEOR 0 0 0 14 0 0 0.029
Q. palustris seedlings QPSE 0 0 0 14 0 0 0.055
Phalaris arundinacea PHAR 0 0 0 i 0 0 0.035
*Polygonum persicaria PLRS 0 0 1 13 0) 0 0.139
Carex — CALU 0 0 0 11 0 0 0.065
Carex typ CATY 0 0 0 11 0 0 0.079
Lobelia surdiedlis LOCA 0 0 0) 11 0 0) 0.078
TYPE V
Osmunda regalis OSRE 0 0 0 0 53 0 0
Quercus bicolor QUBI 0 0 0 0) 39 4 0
Vitis labrusc VILA 0 0 0 0 31 0 0
*Lythrum aon LYSA 0 0) 0 6 25 0 0.003
Cornus amomu COAM 0 0 0 6 24 3 0.013
Lycopus si riak LYUN 0 0 0 0 20 0 0.003
Carex crinita CACR 0 0 0 9 15 0 0.095
reanmend — RH 0 0 0 3 ibs: 6 0.047
Betula BENI 0 0 0 4 13 0) 0.042
GC. “att cacti. QBSE 0 0 0 0 13 8 0.067

SII

vIopouy

IOI ISA]

Table 2. Continued.

Indicator Values by Community Type

Species Name CODE I Il iW IV Vv VI p value
TYPE VI
Acer rubrum ACRU 0 10) 0) 0 13 60 0
Viburnum ae VIDE 0 0 0 0 16 54 0
CAOV 0 0 0 0 0 49 0
Ilex Cepia: ILVE 0 0 0 1 0 47 0
Athyrium felix-femina ATFI 0 0 0 0) 1 37 0
Mai emum canadense MACA 0 0) 0 0 4 a7 0
Uvularia sessilifolia UVSE 0 0 0 0 0 35 0
smunda cinnamomea OSCI 0) 0 0 0 0) 29 0)
Q. bicolor saplings QBSA 0 0) 0 0 0) P| 0.003
Tilia american TIAM 1 0 0 0 0 19 0.004
P. serotina seedlings PSSE 0 0 0 0 0 14 0.017
Ulmus american ULAM 2 2 2 1 6 12 0.308
Circaea lutetiana ssp. CIQU + 1 1 0 1 11 0.206
canadensis
gercmiais quinquefolia PAQU a 4 0 3 0 11 0.825
A. rubrum seedlings ARSE 0 @) 0 1 0 10 0.068
Prunus een PRSE 4 0 0 0 5 6 0.511

[6661

SeUNUIWOD 3seI0,j ure[|dpool,.j—Ae|sieoy

120 Rhodora [Vol. 101

Variation in abundance of woody vines along DCA Axis 1 was
associated with an increase in Vitis labrusca and a decrease in V.
riparia (Figure 4); V. labrusca attained its highest indicator value
in Type V, while V. riparia was most abundant in Type I (Table
2). Toxicodendron radicans occurred across all plots, but was
most abundant in Types III, IV, V, and VI (Table 2). Variation in
herbaceous species composition across DCA Axis 1 was associ-
ated with a decrease in Matteuccia struthiopteris and Laportea
canadensis and an increase in Osmunda regalis and O. cinna-
momea (Figure 4). Boehmeria cylindrica and Onoclea sensibilis
had intermediate Axis | loading scores (Figure 4) and high in-
dicator values for Types III, IV, and V (Table 2). Variation in
herbaceous species composition across Axis 2 was associated
with decreasing L. canadensis and increasing Impatiens pallida
and M. struthiopteris (Figure 4).

Community structure was similar among floodplain forest
types, and the six community types did not differ significantly in
the height and total percent cover of vegetation strata (MRPP p
= 0.45). All types were characterized by a dense, tall tree canopy
(20 m mean height, 70% mean cover) above a diffuse subcanopy
(7 m mean height, 19% mean cover) and very limited to absent
shrub layer (1.5 m mean height, 9% mean cover). The herbaceous
cover was dense (80% mean cover) in most plots, and tall (1-2
m) when Laportea canadensis or Impatiens spp. were dominant
(Types I and II; Table 2). Species richness was not significantly
different among identified types (p = 0.217), but types did differ
significantly in species diversity (p = 0.029) and species evenness
(p = 0.0004) with Type VI forests having the highest values for
both (H’ = 1.75, E = 0.71).

Environmental parameters. Soil profiles of Types II, IV,
V, and VI were typically hydric silt loams with soil mottling,
while soil profiles of Types I and II were nonhydric, sandy loams,
loamy sands, or sands without soil mottling (Table 3). Soil pro-
files of Types V and VI usually had a surface organic layer, while
soil profiles of Types I, II, and III usually lacked a surface organic
layer (Table 3). Soil pH was least acidic in Types I, II, and III
(Table 3).

Results of the MRPP of soil variables showed that the observed
differences in soil profiles among the six floodplain forest com-
munity types were statistically significant (p = 0.001). Soil tex-

1999] Kearsley—Floodplain Forest Communities 121

ture, pH, and presence/absence of soil mottles, surface organic
layer, and hydric soils were all significantly different (p < 0.001)
among community types, while depth to mottling and depth of
organic layer were not significantly different (Table 3).

Presence/absence of floodlines and topographic position were
also significantly different among defined types (p < 0.001). Most
floodplain plots occurred on level floodplains, except for Type I
communities which typically occurred on elevated sections of riv-
erine islands and Type VI communities which occurred on ridges
or high terraces (Table 3). Floodlines were visible on tree trunks
in 41% of all plots, and they were most common in communit
Types III and IV (Table 3). Snapped trunks were observed in
34% of all plots, uprooted trunks in 7%, and stumps (cut or bea-
ver-cut) in 16%. When present, there were usually only one or
two downed trees per 0.02 ha plot, and downed trees did not
appear to be abundant overall in the floodplain forests invento-
ried.

COMMUNITY TYPE DESCRIPTIONS

Type I—Riverine island floodplain forests (Acer sacchar-
inum—Populus deltoides—Acer negundo—Matteuccia struthiop-
teris association). Type I communities (12 plots at 8 sites) were
open-canopy floodplain forests occurring on elevated sections of
riverine islands and riverbanks of major rivers with high levels
of disturbance. The community type was limited to the Connect-
icut, Deerfield, and Housatonic Rivers in Massachusetts (Table
4). Plots classified as Type I were most likely to occur at sites
where the vegetation in all plots at the site was classified as Type
I. Table 5 shows that of the eight sites with plots classified as
Type I, five had all plots classified as Type I, three had plots
classified as both Types I and II, and one had plots classified as
Types I, II, and III. Type I communities were never associated at
sites with vegetation classified as Types IV, V, or VI (Table 5).
Soils of Type I communities were typically nonhydric, sandy
loams without soil mottles and without a surface organic layer.
Soil pH ranged from 5.5 on the Connecticut and Deerfield River
plots to 8.0 on the Housatonic River (Table 3).

The overstory of Type I communities was a mixture of Acer
saccharinum and Populus deltoides. Platanus occidentalis and

Table 3. Environmental data for floodplain forest community types. *Soil texture: S = San
Loam, ST = Silt Loam. **Topographical position of plots within floodplain

DP = Depression.

d, LS = Loamy Sand, SL = Sandy
: TR = Terrace, LF = Level Floodplain, LE = Levee,

% of Plots
with Soil
% of Plots Organic
ith Soil Layer % of % of Plots
Pe IONE 4 of Plots wih eck © ea wes % of Plots in each
ber (me *Soil Texture at 10 cm depth wit — Fipodlines **Topographical Position
of depth of, in Mean pH___ Hydric (height range peerer
Type Plots to, in cm) s LS SL Si cm) (range) Soil in cm) TR LF LE. “DP
I 11 0 0 0 2°94 0 6.6 (5.5-8.0) O 36 (43-135) 64 27 9 0
I ae AZAD 5 14 50 ai 4 (1.0) 6.3 (4.5-8.0) 0 13 (93-220) 13 S61 26 0
il 16 75 (18.3) 0 G i= 3] 63 0 6.2 (4.5-8.0) 38 62 (60-303) 19p 75 0 6
IV 16 88 (14.0) 6 6 2B 76 = =35. (5.0) 5.2 (4.5-6.0) 59 69 (44-265) 0 94 6 0
Vv 17 67 (26.1) 0 6 > 27 67 67 (5.0) 4.8 (4.5-5.5) 40 47 (45-122) 0 80 7 13
VI se “60(173) —0 0 40 60 60(5.3) 5.0 (4.5-6.0) 40 0 60 40 0 0)
ALL ar SSG Ss 2 5 i 42 S51 23 (4.8) 5.7 (4.5-8.0) 30 41 (43-303) 19e- 73 10 3

col

elopoyy

TOT TOA]

1999] Kearsley—Floodplain Forest Communities 123

Table 4. oe of plots by each river in the defined floodplain forest
community ty

Community Type

Basin River I | Gakias |5 Wieaire 5 Vooryy
Blackstone Blackstone 1
Connecticut Connecticut 5. 20 1
Connecticut tributaries 1 er 12 2
Deerfield 2 8 1

Housatonic Housatonic 1 3 8

Ipswic Ipswich

Merrimack Assabet 1 2 1
Concord 4
Merrimack 2
Nashua 1 5 9
Nashua tributary 3
Shawsheen 2 4

Taunton Threemile 3 2 1
Totals Boy 2 bo eR aS 14

Fraxinus americana were occasional canopy associates. Ulmus
rubra, A. negundo, and Celtis occidentalis (on the Housatonic
River) were common in the subcanopy (Table 2). The shrub/sap-
ling layer was patchy and composed of taxa typical of disturbed
areas, including Rhus typhina, Rosa multiflora, Berberis thunber-
gui, and Celastrus orbiculata. Berberis thunbergii was observed
n this floodplain forest community type more frequently than in
any other (Table 2). The herb layer was dominated by Matteuccia
struthiopteris (most plots had greater than 40% cover) or by a

Table 5. Number of sites with plots of one defined floodplain forest com-
munity type that also have plots of other community types.

Total #
of Sites
with
Plots of
Type I Type II Type III Type IV Type V Type VI Type

Type I 5 3 1 8
Type I 3 7 7 I?
Type Il 1 7 3 1 11
Type IV 1 ii 4 a 2
Type V ~ 2 3 6
Type VI S 3 2 =

124 Rhodora [Vol. 101

dense, tall layer of Jmpatiens pallida over M. struthiopteris. La-
portea canadensis occurred in low amounts but was never abun-
dant. Other common herbaceous taxa were Eupatorium rugosum,
Arisaema triphyllum, and Geum canadense. Vitis riparia was a
strong indicator vine (Table 2), and Parthenocissus quinquefolia
was also common.

Type Il—Major-river floodplain forests (Acer saccharin-
um—Populus deltoides—Laportea canadensis association). Type
II communities (32 plots at 17 sites) occurred on mainstem sec-
tions of the Connecticut, Deerfield, and Housatonic Rivers (Table
4). Plots classified as Type II were most likely to occur at sites
with other plots classified as Type II or at sites with plots clas-
sified as Type III (Table 5). Type II communities sometimes oc-
curred associated with vegetation classified as Type I, but never
with Types IV, V, or VI (Table 5). Soils were predominantly sandy
loams without soil mottles (13% of plots had mottles) and without
a surface organic layer (only 4% of plots had an organic layer).
Soil pH ranged from 4.5 on the Connecticut and Deerfield Rivers
to 8.0 on the Housatonic (Table 3).

Acer saccharinum was strongly dominant in the overstory
(>60% cover in most plots) mixed with lesser amounts of Po-
pulus deltoides. Ulmus americana and/or U. rubra occurred in
the subcanopy. Shrubs were generally lacking. The herbaceous
layer was usually dominated by a 1-2 m tall, dense cover of
Laportea canadensis, and Matteuccia struthiopteris was some-
times abundant. Leersia virginica was consistently represented,
but in low amounts (typically <5% cover). Other common as-
sociates were Cinna arundinacea, Impatiens sp., Boehmeria cy-
lindrica, and Arisaema triphyllum. Non-native plant species were
usually less abundant than in Type I communities, but Polygonum
cuspidatum often formed large patches along heavily scoured le-
vees or in areas where the canopy was open. Other common non-
native taxa were Glechoma hederacea and Alliaria petiolata.

Type II—Transitional floodplain forests (Acer saccharin-
um—Arisaema dracontium association). Type III communities
(19 plots at 11 sites) occurred on third-order or smaller tributaries
of the Connecticut River, on the Housatonic River, and in de-
pressions within Major-river floodplain forests (Types I and II)
of the Connecticut and Deerfield Rivers (Table 4). Plots classified

1999] Kearsley—Floodplain Forest Communities 125

as Type III were found associated at sites with plots classified as
Types I, II, and IV (Table 5). Type III communities were inter-
mediate in soil texture and drainage between the sandy, well-
drained soils of Types I and II and the highly mottled, poorly
drained silt loams of Type IV. Soil texture was silt loam or very
fine sandy loam. Soils were poorly drained, and 75% of plots had
soil mottling. None of the plots had a surface organic layer. The
pH ranged from 4.5 to 8.0 (Table 3).

The Type III vegetation association was transitional between
Major-river (Types I, II) and Small-river (Type IV) floodplain
forest vegetation, and shared taxa with Types I, II and IV (Table
2; Figure 3). In Type III communities, Acer saccharinum was
dominant in the canopy, but unlike Types I and II, Populus del-
toides was typically absent. As in Type IV plots, Fraxinus penn-
sylvanica and Ulmus americana were present. A shrub layer was
lacking; however, saplings of overstory trees were common.
Vines were abundant with Amphicarpaea bracteata most com-
mon. In contrast to Type II plots, Laportea canadensis was not
dominant, but it was present in low amounts in all plots (5—15%
cover). The herbaceous layer was typically an even mixture of L.
canadensis, Matteuccia struthiopteris, Onoclea sensibilis, and
Boehmeria cylindrica. Common associates were Leersia virgini-
ca, Arisaema triphyllum, Bidens frondosa, Cinna arundinacea,
and Impatiens sp. Arisaema dracontium (a state-protected rare
species) was associated with this floodplain forest community
type and serves as a good indicator species of the type (Indicator
value = 16; Table 2; Kearsley 1999).

Type IV—Small-river floodplain forests (Acer saccharin-
um-—Fraxinus pennsylvanica—Quercus palustris associa-
tion). Type IV communities (28 plots at 12 sites) occurred on
third order or smaller tributaries of the Connecticut and Nashua
Rivers, on smaller rivers of eastern Massachusetts where banks
are low and overbank flooding occurs (Ipswich, Assabet, Shaw-
sheen, and Threemile), and on edges of riverine islands of the
Merrimack River (Table 4). Vegetation classified as Type IV was
sometimes associated at sites with vegetation classified as Types
Ill, V, and VI (Table 5). Soils were a mixture of silt loams and
fine sandy loams. Fifty-nine percent of soil profiles were classi-
fied as hydric; 88% had soil mottles and 35% had a surface or-
ganic layer. The pH ranged from 4.5 to 6.0 (Table 3).

126 Rhodora [Vol. 101

As in Types I, II, and Ill, Acer saccharinum was dominant in
the overstory of Type IV communities, but the understory of Type
IV communities more closely resembled that of A. rubrum A\l-
luvial swamp forests (Type V) and Alluvial terrace forests (Type
VI). Populus deltoides and A. rubrum were both absent in the
canopy of Type IV communities. Quercus palustris was a com-
mon associate in the Connecticut River basin, and Betula nigra
in the Merrimack River basin. Type IV floodplain forest plots had
a more substantial shrub layer than both Major-river (Types I and
II) and Transitional (Type III) types, but less than both Types V
and VI. The shrub layer of Type IV communities consisted main-
ly of Cornus amomum and Cephalanthus occidentalis. Fraxinus
pennsylvanica saplings were present in most plots

ere was greater herbaceous diversity in Small-river flood-
plain forests than in floodplain forest Types I, II, and III. Onoclea
sensibilis and Boehmeria cylindrica were most common, but as-
sociates included Acer saccharinum seedlings, Cicuta maculata,
Lysimachia terrestris, Sium suave, and non-native taxa, such as
L. nummularia, Myosotis scorpioides, Rhamnus frangula, and
Lythrum salicaria. Four state-protected rare plant species were
associated with this community type: Mimulus alatus (State En-
dangered), Carex typhina (State Threatened), C. grayi (State
Threatened), and Rumex verticillatus (State Threatened; Kearsley
1999).

Type V—Alluvial swamp forests (Acer rubrum—A. sacchar-
inum-—Quercus bicolor association). Type V plots (15 plots at
6 sites) occurred along mainstem sections of smaller rivers in east-
ern Massachusetts (Assabet, Concord, Nashua, Shawsheen, and
Threemile; Table 4). Plots classified as Type V were often asso-
ciated at sites with plots classified as Types IV and VI (Table 5).
This type appeared to be wetter and more seasonally inundated
than the four Acer saccharinum dominated types (Types I-IV).
Soils were typically silt loams; 67% had soil mottles and 67% had
a surface organic layer. The pH ranged from 4.5 to 5.5 (Table 3).

Vegetation of plots classified as Type V was variable, as in-
dicated by the lack of strong clustering in the DCA analysis (Fig-
ure 3). In general, the overstory of Type V plots was character-
ized by a mixture of Acer saccharinum and A. rubrum with lesser
amounts of Fraxinus pennsylvanica and/or Quercus bicolor. Un-
like Types I-IV, Type V communities had a well-developed shrub

1999] Kearsley—Floodplain Forest Communities F27

layer dominated by Viburnum dentatum, Cornus amomum, and
the non-native plant Rhamnus frangula. As in Type IV commu-
nities, the herbaceous layer of Type V communities was charac-
terized by a mixture of Onoclea sensibilis and Boehmeria cylin-
drica; however, the herbaceous layer differed in also having Q.
bicolor seedlings, Osmunda regalis, and Carex crinita.

Type VI—Alluvial terrace forests (Acer rubrum—Carya ova-
ta—Prunus serotina association). Type VI plots (14 plots at 5
sites) occupied upland ridges within Alluvial swamp forests (Type
V) and high terraces above the active flood zone. Plots of this type
occurred on the Nashua, Assabet, Blackstone, and Threemile Riv-
ers and on high terraces in the Connecticut River basin (Table 4).
Vegetation classified as Type VI was often associated with Types

and V (Table 5). Type VI forests were river influenced and
mesic, but they did not appear to experience regular flooding as
indicated by the presence of a distinct soil organic layer. Soils were
typically silt loams; 60% had soil mottles and 60% had a surface
organic layer. The pH ranged from 4.5 to 6.0 (Table 3).

This community type showed the greatest within-group vari-
ability in plot composition, as indicated by the point spread in the
DCA output (Figure 3). Although the plots were not highly clus-
tered, they were well-differentiated from the other five floodplain
forest community types. Acer rubrum was dominant in the canopy,
and typically mixed with varying amounts of mesic hardwoods
including Carya ovata, Prunus serotina, Ulmus americana, and
Tilia americana, As in Type V communities, the shrub layer was
well-developed, and Viburnum dentatum and Ilex verticillata were
most common. The herbaceous layer was a species-rich mixture
of Onoclea sensibilis, Maianthemum canadense, Athyrium felix-
femina, Osmunda cinnamomea, and Uvularia sessilifolia.

DISCUSSION

The greatest differences in vegetation composition and envi-
ronmental characteristics among the floodplain forest community
types occurred between Types I-III and Types IV—VI. These two
groups were well-separated floristically, environmentally, and
spatially. Types I-III occurred at sites on the Connecticut, Deer-
field, and Housatonic Rivers, and Types IV and V occurred on
small tributaries of the Connecticut River or on rivers in eastern

128 Rhodora [Vol. 101

Massachusetts. Type VI occurred on elevated ridges and high
terraces across the state, but more data are needed to clarify the
distribution of and variation in high-terrace forests statewide.

Vegetation classified as Types I, II, and III often occurred to-
gether at a site. Sites with vegetation that was primarily classified
as Type II had patches, usually on elevated sections, where Mat-
teuccia struthiopteris was dominant (Type I), and depressions
where Boehmeria cylindrica and Onoclea sensibilis were domi-
nant (Type III). Similarly, sites with vegetation primarily classi-
fied as Type III had elevated sections dominated by Laportea
canadensis (Type II). Overlap between community types within
a single site also occurred among Types IV, V, and VI. Type IV
forests in eastern Massachusetts had Quercus bicolor dominant
(Type V) in low-lying, wet depressions and mesic, mixed-decid-
uous patches (Type VI) in elevated areas.

Although Types I-III and Types IV—VI were generally well-
differentiated, overlap among defined community types did occur,
particularly among Types III, IV, and V. These three ty e
all characterized by Boehmeria cylindrica and Onoclea sensibilis
in the herbaceous layer, and differences in vegetation composition
among the three types was subtle; however, differences in soil
profiles 3g location supported the three types as recognizable as-
sociation

Types 1 and II were also similar, and the differences observed
in vegetation composition appeared to be primarily related to
greater disturbance in areas classified as Type I. Riverine islands

of the Connecticut and Deerfield Rivers where Type I vegetation
assemblages were found had many canopy openings that were
created by campers. Abandoned campsites were filling in with
Rhus typhina, Polygonum cuspidatum, and a mixture of vines,
including Celastrus orbiculata and Vitis riparia. The abundance
of Acer negundo, which was associated with open, disturbed areas
of Ohio floodplain forests (Hardin et al. 1989), was also indicative
of greater disturbance in Type I forest plots.

Comparison to other floodplain forest classifications. Type
I and II Major-river floodplain forests are similar in vegetation
composition to floodplain forests of larger rivers in other New
England states. Type I forests correspond to the Acer negundo—
Matteuccia struthiopteris association described in Vermont,
which occurs on sandy loams or open cobbles within the active

1999] Kearsley—Floodplain Forest Communities 129

floodplain of larger rivers. Type II forests correspond to Ver-
mont’s A. saccharinum—M. struthiopteris association, which oc-
curs on coarse soils of levees of larger rivers (Sorenson et al.
1998). Elsewhere in New England a distinction between the two
community types has not been made; however, Types I and II
hs correspond to the A. saccharinum—M. struthiopteris—La-

rtea ees association in New Hampshire (Bechtel and
shes 1998), . Saccharinum—Eupatorium rugosum asso-
ciation in pe omealrsiee (Metzler and Damman 1985), and to the
A. saccharinum temporarily flooded forest alliance described for
the eastern United States (Sneddon et al. 1998). Type I also con-
tains elements of the A. negundo temporarily flooded forest alli-
ance described for the Southeast which includes early succes-
sional vegetation of active floodplains and sandbars with a heavy
vine component (Sneddon et al. 1998).

ype Ill Acer saccharinum—Fraxinus pennsylvanica—Ulmus
americana floodplain forests correspond to A. saccharinum/On-
oclea sensibilis floodplain forests described for Connecticut
(Metzler and Damman 1985). Similar to Type III forests, Mat-
teuccia struthiopteris was the dominant herbaceous taxon on the
highest ridges within the community type in Connecticut (Metzler
and Damman 1985). Type III forests are also closely affiliated
with A. saccharinum—O. sensibilis-Boehmeria cylindrica com-
munities occurring on silty soils of lower watersheds and lake-
shores in Vermont (Sorenson et al. 1998) and A. saccharinum—
Carex crinita—O. sensibilis associations in New Hampshire (Be-
chtel and Sperduto 1998). Type III forests correspond to the A.
saccharinum-U. americana—O. sensibilis temporarily flooded for-
est community described for the Northeast (Sneddon et al. 1998).

oodplain forest associations similar in composition to Types
I, Il, and III also occur on large rivers throughout the north-
central United States. Acer saccharinum dominated forests have
been described in detail in southeastern Wisconsin (Dunn and
Stearns 1987; Menges 1986; Menges and Waller 1983), Ohio
(Hardin et al. 1989; Hardin and Wistendahl 1983), northern Mis-
souri (Dollar et al. 1992), New Jersey (Buell and Wistendahl
1955; Frye and Quinn 1979) and central Illinois (Brown and Pe-
terson 1983; Peterson and Rolfe 1982). In all the forests de-
scribed, A. saccharinum was mixed with Fraxinus pennsylvanica
and Ulmus americana in the canopy, and Laportea canadensis
was a major component of the understory.

130 Rhodora [Vol. 101

Type IV forests are similar in vegetation composition and
structure to Quercus palustris—Fraxinus pennsylvanica forests de-
scribed in Connecticut (Metzler and Damman 1985), Acer rub-
rum/Onoclea—Boehmeria alluvial forests in Rhode Island (Barrett
and Enser 1997), and Q. palustris—A. rubrum—Carex grayi-Geum
canadense temporarily flooded forests described for New England
(Sneddon et al. 1998). Type IV forests as described here differed
from the above community types in having A. saccharinum rather
than A. rubrum codominant with Q. palustris in the overstory.

Floodplain forest plots classified as Type V appeared to be
seasonally saturated as indicated by prominent soil mottling close
to the soil surface. Type V forests are similar in composition to
Acer rubrum—Onoclea sensibilis forested wetlands found on poor-
ly drained glacial lake sediments in Connecticut (Metzler and
Tiner 1992) and to A. rubrum alluvial forests described for Mas-
sachusetts oxbows (Holland and Burk 1984). They correspond to
the A. rubrum—Fraxinus pennsylvanica seasonally flooded forest
alliance of low terraces and bottomlands occurring throughout the
Eastern United States (Sneddon et al. 1998), and they are prob-
ably common in Massachusetts. Acer rubrum alluvial swamp for-
ests similar to Type V forests have been described as a species-
rich variant of A. rubrum swamps that are abundant throughout
southern New England (Golet et al. 1993).

Type VI includes high floodplains that are flooded very infre-
quently, perhaps no more than several times per century (Jahns
1947). Type VI forests are similar in composition to high-terrace
Acer saccharum-Tilia americana—Matteuccia struthiopteris for-
ests in Vermont (Sorenson et al. 1998) and to high-terrace A.
saccharum—A. saccharinum—Fraxinus americana forests in New
Hampshire (Bechtel and Sperduto 1998), except that A. sacchar-
um was uncommon in high-terrace plots in Massachusetts. Type
VI forests are most closely related to A. rubrum—Prunus serotina/
Athyrium felix-femina forests in New Hampshire which also had
Maianthemum canadense and Uvularia sessilifolia as common
associates (Bechtel and Sperduto 1998).

Vegetation patterns in relation to environmental parame-
ers. The relationships between vegetation patterns and soil
characteristics shown here are similar to those found across flood-
plain forest communities of the north-central United States. In
New York, Acer saccharinum—Fraxinus Sp. associations similar

1999] Kearsley—Floodplain Forest Communities 131

to Types III and IV occurred on fine-textured soils, while Populus
deltoides—Platanus occidentalis—Ulmus sp. associations similar to

ype I occurred on coarser-textured, alluvial sands and gravels
(Huenneke 1982). In southern Illinois, Robertson and Weaver
(1978) found that Fraxinus pennsylvanica attained its highest im-
portance under prolonged and deep flooding, and occurred only
at sites that had mottling near the surface. In Massachusetts, F.
pennsylvanica attained its highest indicator values of 19 and 6 in
community Types IV and V, respectively (Table 2). Results of
the current study support the conclusions of Veneman and Tiner
(1990) that Boehmeria cylindrica is restricted to hydric floodplain
forest soils, while Laportea canadensis and Matteuccia struthiop-
teris are restricted to nonhydric soils. Boehmeria cylindrica was
an indicator of floodplain forest community Types III, IV, and V,
which occurred mainly on hydric silt loams. Matteuccia stru-
thiopteris and L. canadensis were strong indicators of Type I and

ype Il, respectively, which both had predominantly coarse-tex-
tured, nonhydric soil profiles.

Soil pH was significantly different among floodplain forest
community types in Massachusetts because there was a strong
geographical distributional pattern among types, and soil pH ap-
peared to be correlated with geographic location. Soils on the
Connecticut, Deerfield, and Housatonic Rivers all had higher pH
than those along rivers in eastern Massachusetts (Tables 3 and 4).
That difference may be, in part, related to differences in flooding
frequency among rivers. Dollar et al. (1992) found soil pH to be
the closest correlate with variation in vegetation in northern Mis-
souri floodplain forests and suggested that sites with higher flood-
ing frequency and input of fresh alluvium had higher pH. This is
supported in Massachusetts, where Types I, II, and IL, which
were located on large rivers with broad alluvial deposits (the Con-
necticut, Deerfield, and sections of the Housatonic Rivers), had
the highest mean pH values. High pH values on the Housatonic
River (pH 7-8) are also related to the influence of carbonate rich

edrock in western Massachusetts.

CONSERVATION IMPLICATIONS

Thirty-eight natural or semi-natural true floodplain forest sites
(Types I-IV) ranging in size from 1 to 30 ha were identified in
Massachusetts: 20 were primarily Major-river floodplain forest

132 Rhodora [Vol. 101

communities (Types I and II), 6 were Transitional (Type III), and
12 were Small-river types (Type IV). Of the 38 sites identified,
only 10 were found to be high-quality examples based on their
condition, size, and landscape context. The ten high-quality flood-
plain forests included five Major-river sites (four on the Con-
necticut River and one on the Housatonic River), one Transitional
site on the Mill River in Hatfield, and four Small-river sites (three
in the Connecticut River basin and one on the Threemile River).

With the exception of the one site on the Housatonic River, all
of the high-quality examples of Major-river floodplain forests oc-
curred on either public land or privately owned conservation land.
Transitional and Small-river floodplain forests are less well-pro-
tected in Massachusetts. Due to their limited occurrence in the
state and the habitat that they provide for five state-protected rare
plant species, Transitional and Small-river floodplain forest com-
munities warrant active protection efforts.

Although land acquisition and conservation restrictions are im-

their distribution, vegetation composition, environmental charac-
teristics, and quality in Massachusetts. Type V Alluvial swamp
forests are probably widespread, but high-quality examples may
be limited. An in-depth inventory and classification of those com-
munities is warranted with emphasis on identifying remaining
high-quality examples.

Type VI High-terrace floodplain forests are very limited in
Massachusetts because most river terraces have been cleared and

ine a

1999] Kearsley—Floodplain Forest Communities 133

converted to agriculture. Some high-terrace forests occur on the
Millers, Westfield, and Green Rivers and parts of the Connecticut
River, but more detailed inventories and vegetation and environ-
mental analyses are warranted.

ACKNOWLEDGMENTS. I am indebted to the many people who
helped make this project possible. I would especially like to thank
Pat Swain for her assistance in the field and for her insights and
support throughout the project. Rebecca Anderson provided dedi-
cated and invaluable volunteer field assistance during the field sea-
son. Darren Singer, Karen Searcy, Pam Weatherbee, Matt Hickler,

Betty Anderson also assisted with field data collection. Jeanne An-
derson and the Massachusetts Audubon Society (MAS) contributed
site information and data from MAS properties. Janice Stone and
Donna Peterson at the University of Massachusetts Resource Map-
ping Center helped with air photo interpretation. Peter Fletcher, Al
Averill, and Peter Veneman provided help with soil samplin
methodology. Study design and data interpretations benefited great-
ly from discussions with Glenn Motzkin, Pat Swain, David Foster,
Doug Bechtel, Eric Sorenson, Dan Sperduto, Julie Lundgren, and
Mark Anderson. Figure 1 was prepared by Dorothy Graaskamp at
the Massachusetts Department of Fisheries, Wildlife and Environ-
mental Law Enforcement’s Geographical Information Systems Pro-
gram. I also thank Henry Woolsey and the Massachusetts Natural
Heritage Program staff for their support. This project was funded
in part by a State Wetlands Protection Development Grant from
the U.S. Environmental Protection Agency.

LITERATURE CITED

BaiLey, R. G. 1995. Description of the Ecoregions of the United States, 2nd
. Misc. aay No. 1391 (rev.), U.S.D.A. Forest Service, Washington, DC.
BARRETT, N. AND R. ENSER. 1997, Alluvial plant communities within the
span Rasta major basin, Rhode Island. Unpubl. report, Rhode Is-
land Natural Heritage Program, Providence, RI
BECHTEL, D. A. AND D. D. SperpuTo. 1998. Floodplain forest natural com-
munities along major rivers in New Hampshire. Unpubl. report submitted
to the U.S. Environmental Protection Agency, New Hampshire Natural
Heritage Inventory Program, Concord, NH.
Brown, S. AND D. L. PETERSON. 1983. Structural characteristics and biomass

134 Rhodora [Vol. 101

production of two Illinois bottomland forests. Amer. Mid]. Naturalist
110: 107-117.

BuELL, M. EF AND W. A. WISTENDAHL. 1955. Floodplain forests of the Raritan
River. Bull. Torrey Bot. Club 82: 463-472.

Do.iar, K. E., S. G. PALLARDY, AND H. G. Garret. 1992. Composition and
environment of floodplain forests of northern Missouri. Canad. J. Forest.
Res. 22: 1343-1350.

DuFRENE, M. AND P. LEGENDRE. 1997. Species assemblages and indicator spe-
cies: The need for a flexible asymmetrical approach. Ecol. Monogr. 67:
345-366.

Dunn, C. P. AND FE STEARNS. 1987. A comparison of vegetation and soils in
floodplain and basin forested wetlands of southeastern Wisconsin. Amer.
Midl. Naturalist 118: 374—

Frye, R. J., II AnD J. A. QUINN. 1979. Forest development in pate to
topography and soils on a floodplain of the Raritan River, New Jerse
Bull. Torrey Bot. Club 106: 334-345.

GoLeET, F C., A. J. K. CaLHoun, W. R. DERAGON, D. J. Lowry, AND A. J.
GoLD. 1993. Ecology of Red Maple Swamps in the Glaciated Northeast:
A hae Profile. Biological Report 12, U.S. Dept. of Interior, Fish
and Wildlife Service, Washington, DC

GrirFiTH, G. E., J. M. OMERNIK, S. M. PIERSON, AND C. W. KIILSGAARD, 1994,
The Massachusetts Ecological Regions Project. Publication No. 17587-
74-6/94-DEP, U.S. Environmental Protection Agency, Washington, DC.

Haro, E. D., K. P. Lewis, AND W. A. WISTENDAHL. 1989. Gradient analysis
of floodplain forests along three rivers in unglaciated Ohio. Bull. Torre ey
Bot. Club 116: 258-264

D W. A. WISTENDAHL. 1983. The effects of floodplain trees on
Bienen vegetation patterns, microtopography and litter. Bull. Torrey
Bot. Club 110: 23-30.

HILL, M. O. 1979a. TWINSPAN—a FORTRAN program for arranging mul-
tivariate data in an ordered two-way table by Semaine of the indi-
viduals and attributes. Cornell University, Ithaca,

——— 1979b. DECORANA—a FORTRAN p rogram as detrended corre-
spondence analysis and reciprocal averaging. ‘Co mell University, Ithac

a M. M. ann C. J. Burk. 1984. The herb — of three ait

oxbow swamp forests. Rhodora 86: 397-415.

eeranici L. E 1982. Wetland forests of Tompkins County, New York. Bull.
Torrey Bot. Club 109: 51-63.

JAHNS, R. H. 1947. Geologic Features of the Connecticut Valley, Massachu-
setts, as Related to Recent Floods. Water-Supply paper 996, U.S. Dept.
of Interior, Washington, DC.

Kartesz, J. T. 1994. A A i ia of the Vascular es of the
United States, Canada, and Greenland. 2nd ed. Timber Press, Portland, OR.

KEARSLEY, J. B. 1999. Rare te non-native plants of eae aaENr flood-
plain forests. Rhodora 101:200—205.

McCune, B. AND M. J. MEFFORD. 1997. PC-ORD. Multivariate Analysis of
Ecological Data, Version 3.0. MJM Software Design, Gleneden Beach, OR.

MENGEs, E. S. 1986. Environmental correlates of herb species composition

1999] Kearsley—Floodplain Forest Communities 135

in ast hci Wisconsin floodplain forests. Amer. Midl. Naturalist
hg

DAR. i WALLER. 1983. Plant strategies in relation to elevation
sai light in floodplain herbs. Amer. Naturalist 122: 454-473.

METZLER, K. J. AND A. W. H. DAMMAN. 1985. Vegetation patterns in the
Connecticut River flood plain in bee to frequency and duration of
oe Naturalist Canad. 112: —547.

DR. W. Tiner. 1992. ct of Connecticut. Report invest. 13,
eataiciens Geological and Natural History Survey, Hartford, CT.
MorzkIn, G. 1993. Uncommon plant communities of the Connecticut Valley,
Massachusetts. Unpubl. report, Massachusetts Natural Heritage and En-

dangered Species Program, Westborough, MA.

. 1995. Inventory of uncommon plant communities of western Mas-

sachusetts: 1993-1994. Unpubl. ee niacarie ni Natural Heritage
and Endangered Species Program, Westborough, M

NATURAL RESOURCE CONSERVATION SERVICE. {oe Field me for identifying
and interpreting soil condition (Draft). Unpubl. draft, Natural Resource
Conservation Service, Washington, DC.

PETERSON, D. L. AND G. L. ROLFE. 1982. Nutrient dynamics of herbaceous
vegetation in upland and floodplain forest communities. Amer. Midl.
Naturalist 107: 325-339.

ee a A. AND G. T. WEAVER. 1978. Vegetation and tree species pat-
terns near the northern terminus of the southern floodplain forest. Ecol.

SEARCY, K. B., B. LINDWALL, AND T. Enz. 1993. Plant community and veg-
etation analysis of floodplain areas along the Nashua River, Fort Devens,
with particular emphasis on the floodplain and adjacent slopes of the

Massachusetts Natural Heritage and Endangered Species Program, West-

borough, :

SNEDDON, L., M. ANDERSON, AND K. METZLER, eds. 1998. International clas-
sification of ecological communities: Terrestrial vegetation of the Eastern
Region (draft 2/98). Unpubl. report. The Nature Conservancy, Eastern
Regional Sie Boston, MA

SocoLow, R. S., L. ¥. Comeau, R. G. CASEY, AND L. R. RAMSBEY. 1995.
Water a Data: Massachusetts and Rhode Island Water Year
1995. Water-Data report MA-RI-95-1, U.S. Geological Survey, Wash-

ington }

Gan E., M. Lapin, B. ENGSTROM, AND R. Popp. 1998. Floodplain forests
of Vermont: Some sites of ecological significance. Unpubl. report s
— to the U.S. Environmental Protection Agency, Vermont Nongame

Natural Heritage Program, Waterbury, VT.
Tuostson, E. AND J. JENKINS. 1992. Natural communities of the Deerfield

VENEMAN, P. L. M. AND R. W. TINER. ren So oil-vegetation correlations in
the Connecticut River floodplain of western Massachusetts. Biological
Report 90(6), U.S. Fish and Wildlife ie. shington, DC.

ZIMMERMAN, G. M.., OETZ, AND . MIELKE, JR. 1985. Use of an im
reiki ‘statistical method for group ce a study effects of prai-

e fire. Ecology 66: 606-611

RHODORA, Vol. 101, No. 906, pp. 136-142, 1999

JALTOMATA LOJAE (SOLANACEAE): DESCRIPTION AND
FLORAL BIOLOGY OF A NEW ANDEAN SPECIES

THOMAS MIONE AND Luis A. SERAZO

Department of Biological Sciences, Central Connecticut State University,
New Britain, CT 06050-4010

ern Peru is described. This species is distinguished by the following features:

ible, herkogamous, and sometimes protogynous. Microscopic, densely stain-
ing, multicellular glands that may be osmophores are located on the perianth.
erries are eaten by humans.

Key Words: edible fruit, floral biology, herkogamy, Jaltomata, osmophore,
olanaceae

Jaltomata includes about 40 neotropical herbaceous and shrub-
by species distributed from Arizona, U.S.A., to Bolivia, as well
as on the Galapagos Islands and the Greater Antilles (Mione et
al. 1993). The fruits of most Species are eaten uncooked (Davis
and Bye 1982; Mione 1992). This description of a new species
is a contribution to ongoing systematic studies of this genus (Mi-
one 1999; Mione and Bye 1996; Mione and Leiva 1997).

MATERIALS AND METHODS

136

1999] Mione and Serazo—Jaltomata lojae 137

the nose. To examine seed set, flowers were manually pollinated
during the pistillate and hermaphroditic phases. Undehisced an-
thers were removed at the time of pollination.

TAXONOMIC TREATMENT AND DISTRIBUTION

Jaltomata lojae Mione, sp. nov. TyPE: ECUADOR. Prov. Loja: by
guard station on the E side of Celica, 1950 m, growing along
roadside, 2 May 1991, D. M. Spooner, R. Castillo, and L.
Lépez 5037 (HOLOTYPE: CONN). Figures 1 and 2.

A J. cajamarca Mione atque J. sagasteguii Mione foliis pilis
dactyliformibus, corolla sub anthesi rotata et ovarii disco lato dif-

ert.

Perennial shrub; branches and leaves densely villous, bearing
finger hairs, these sometimes gland-tipped, 0.15—6 mm long, be-
coming less villous with age. Leaves alternate, often geminate,
ovate, to 15 cm long X 6 cm wide, the margin entire to sinuate-
ae Deeper the petiole to 4.5 cm long. Inflorescence um-

, to 9-flowered. Peduncle 5—9 mm long (at flowering),
sedienlé 8-11 mm long (at flowering), both having a dense cov-
ering of erect finger hairs to 1.5 mm long, some hairs gland-
tipped. Calyx (at flowering) light green, 9.5 mm in diameter,
strongly reflexed, abaxially villous with gland-tipped finger hairs,
forked hairs, and dendritic hairs all 1-2 mm long, and abaxially
and adaxially with stalked multicellular glands 62-80 ym long
(Figure 2), at fruit maturity calyx diameter to 12 mm. Corolla
infundibular when partially open, rotate when fully open, white,
with two green proximally positioned maculae straddling the ra-
dial vein to each corolla lobe (Figure 1), 5 prominent lobes al-
ternating with 5 small lobules, 25—27 mm in diameter on plants
we grew, 18 mm in diameter on the holotype, adaxially glabrous,
abaxially with sparsely but evenly distributed stalked multicel-
lular glands 62—80 ym long (Figure 2). Two classes of hairs ex-
tend out from the corolla margin: marginal hairs to 110 ym long,
and submarginal (attached abaxially) hairs to 0.5 mm long. Sta-
mens 5, 5 mm long; filaments on living plants angling away from
style and slightly curved outward, villous on basal 1/4 of the
length with unpigmented finger hairs to 1.2 mm long; anthers
2.1—2.5 mm long prior to dehiscing, 1.6—-1.8 mm long after de-
hiscing, when corolla is fully open exserted out of corolla 2 mm,

138 Rhodora [Vol. 101

Jaltomata lojae. ER on plant grown from seed of the

Figure 1.
Prt pit, Bac Units are millimete

1999]

Figure 2. Perianth gland (75 ym long). Multicellular head stains deeply
with neutral red, the stalk cell does not. Drawn by L. A. S. from plant grown
from seed of the type collection.

otherwise included. Pollen grains 32.5 1m average diameter (n
= 22 grains). Ovarian nectar disk orange (visible by eye on living
flowers). Style 9-11 mm long, slender and straight (Figure 1),
exserted 3-8 mm beyond the anthers; stigma shallowly bilobed,
0.4 to 0.75 mm wide on pressed specimens, broader than the style
(Figure 1), the papillae 30-60 ym long. Mature fruits orange.

140 Rhodora [Vol. 101

Seeds numerous, ovate to reniform, 1.3—1.6 mm long. Chromo-
some number n = 12 (nine counts).

DISTRIBUTION, ECOLOGY, LOCAL NAMES, USES. This species is dis-
tributed in southern Ecuador and northern Peru in disturbed hab-
itats from 1900 to 2700 m elevation. Its local names are ‘“‘ubillos”’
(Ellemann 66799) and “uvilla’” (van den Eynden and Cueva
342). It has been used ‘“‘for sunburn, used with alcohol for bath’’
(Ellemann 66799) and the fruits are edible (van den Eynden and
Cueva 342).

OTHER SPECIMENS EXAMINED: specimens made from plants grown from
seeds of the type collection Mione 560 (CONN, HAO, MO, NY, QCA).

Ecuador. Prov. CHIMBORAZO: Cafion on the Rio Chanchan, directly above
the village of Huigra, 29-31 May 1945, Camp E-3498 (Ny); Prov. LOJA:
Lugma Huycu 12 km north of Saraguro, 19 Jan 1989, Ellemann 66799 (AAU
not seen, NY); Cerro Sozoranga, Colaisaca-Utuana, km 0.5, 24 Apr 1994,
Jorgensen et al. 567 (MO not seen, Ny); Sevillan, 26 Mar 1995, van den
Eynden and Cueva 342 (LOJA not seen, NY).

Peru. Dept. prura, Prov. Huancabamba: Abra de Porculla, entre Olmos y
Jaén, ladera con monte bajo, 22 Apr 1964, Ferreyra 15667 (kK, us); Carretera
entre Canchaque y Huancabamba, km del 16 al 25 desde Canchaque, 17 Apr
1987, Diaz and Baldeén 2395 (Mo, NY); Perculla, 2 May 1981, Llatas and
Laes 631 (HUT not seen, MO, NY).

FLORAL BIOLOGY

To look for structures that may release scent, flowers were
stained in dilute neutral red for several hours. The stigma (in-
cluding papillae) stained darkly with neutral red but the style did
not. Anthers and pollen stained darkly while filaments did not.
Multicellular glands, located on the abaxial face of the corolla
and both faces of the calyx, stained darkly, except for the stalk
cell (Figure 2). Similar glands have been described on the leaves
of Solanum (Seithe 1979) and Physalis (Seithe and Sullivan
1990). Neither the corolla margin hairs nor the hairs of the fila-
ments absorbed stain. On the multicellular finger hairs only the
glandular tip, when present, absorbed stain. Hand-sections of epi-

ermal tissue of the ovary disk, stained and then observed with
a compound microscope, revealed that the nectary disk absorbs
Stain only in the immediate vicinity of the stomata. The guard
cells stained deeply, and the cells surrounding the guard cells also
absorbed stain but staining was less intense. Flowers produced a

1999] Mione and Serazo—Jaltomata lojae 141

subtle fragrance that was described as licorice-like, vanilla-like,
or faintly sweet by the seven people polled and the authors. (Two
of these people also detected a fragrance in the empty/control
jar.)

Flowers remained open 5 to 7 days (mean 5.7 days, n = 9
flowers) and closed each night. Within an inflorescence one to
four flowers were open at a time. The corolla was pale green
prior to anthesis but after the corolla opened for the first time it
became white and remained white. The anthers of a flower either
dehisced a few at a time over the course of several hours, or two
or three of the anthers dehisced one day and the others dehisced
the next day. Anthers dehisced prior to 8:30 am. Some flowers
exhibited one day of protogyny, with the stigma protruding
through the partially open corolla. Two out of three flowers man-
ually pollinated during the pistillate phase set seed, as did many
(percentage not calculated) of the flowers that were manually pol-
linated during the hermaphroditic phase. In the greenhouse, plants
did not set fruit unless hand-pollinated. This is likely due to her-
kogamy: the stigma is located 3 to 8 mm from the anthers. Nectar
drops at the base of the corolla (alternating with the stamens)
were large enough to be observed by eye. The broad, orange
ovary disk is concentric around the green ovary and increases the
diameter of the ovary by 1 to 1.5 mm over what the ovary di-
ameter would be without the disk. Nectar seemed to be secreted
by the ovarian disk but may also be secreted by the base of the
corolla.

ACKNOWLEDGMENTS. We thank David M. Spooner for seeds
and review of the manuscript, Clinton E. Morse for care of living
plants, Kancheepuram N. Gandhi for Latin translation, and Janet
R. Sullivan and Gregory J. Anderson for review.

LITERATURE CITED

Davis, T. IV AND R. A. BYE, JR. 1982. Ethnobotany and progressive domes-
tication of Jaltomata (Solanaceae) in Mexico and Central America.
con. Bot. 36: 225-241

Kearns, C. A. AND D. W. INouyE. 1993. Techniques for Pollination Biolo-
gists. University Press of Colorado, Niwot, C

Miong, T. 1992. The systematics and speinieien of Tiidonialen (Solanaceae).
Ph.D. dissertation, Univ. Connecticut, Storrs, CT.

142 Rhodora [Vol. 101

. 1999. Jaltomata Il: New combinations for five South American spe-
cies (Solanaceae). Brittonia 51: 31-33.

, G. J. ANDERSON, AND M. NEE. 1993. Jaltomata I: Circumscription,
description and new combinations for five South American species. Brit-
tonia 45: 138-145.

AND R. Bye, Jr. 1996. Jaltomata chihuahuensis (Solanaceae): A new
combination and observations on ecology and ethnobotany. Novon 6:
8-81.

AND S. LeIva G. 1997. A new Peruvian species of Jaltomata (Sola-
naceae) with blood-red floral nectar. Rhodora 99: 283-286.

SEITHE, A. 1979. Hair types as taxonomic characters in Solanum, pp. 307—
319. In: J. G. Hawkes, R. N. Lester, and A. D. Skelding, eds., The
Biology and Taxonomy of the Solanaceae. Linnean Society Symposium
Series No. 7. Academic Press, New York.

DJ. R. SULLIVAN. 1990. Hair morphology and systematics of Phys-

alis (Solanaceae). PI. Syst. Evol. 170: 190-204

RHODORA, Vol. 101, No. 906, pp. 143-162, 1999

THE REPRODUCTIVE BIOLOGY OF
MAGNOLIA GRANDIFLORA

LARRY K. ALLAIN

National Wetlands Research Center, 700 Cajundome Blvd.,
Lafayette, LA 70504

MICHAEL S. ZAVADA! AND DouGLas G. MATTHEWS
Department of Biology, Providence College, Providence, RI 02918

ACT. The reproductive Cape of Magnolia grandiflora was inves-
ested at three localities in south Louisiana. Over the 3—4 day flowering
period, the flowers of M. ine pore dec chaes in sex expression
(protogyny), stigmatic receptivity (self- and cross-compatibility to self-incom-
patibility), UV reflectance (strong reflectance of the stigmas to strong reflec-
tance i

carried pollen, bees (non-native Apis mellifera and indigenous Lasioglossum
bruneri) were frequent floral visitors and were the only floral visitors whose
behavior showed any correlation with the array of floral changes that occurred
over the 3—4 day flowering period.

Key Words: Magnolia grandiflora, reproductive biology, halictid bees, bees

Magnolia is considered to be primitive among angiosperms. A
widely accepted view of the evolution of the flower is the Euan-
thial or Anthostrobilus theory. This hypothesis asserts that the
primitive flower is large, actinomorphic, solitary, white (some-
times pink or yellow), and borne terminally. The primitive flower
may have a showy, undifferentiated perianth and numerous floral
parts arranged spirally on an elongated axis. The stamens are
broad, three veined, and each has four elongate microsporangia
on its adaxial surface. The gynoecium is apocarpous, with con-
duplicate carpels that enclose a few ovules (Arber and Parkin

1907; Bessey 1897, 1915; Canright 1952, 1960; Maneval 1914).
This widely held view of the magnolian flower has been consid-
ered a theoretical starting point for understanding angiosperm
evolution (e.g., Cronquist 1981). However, recent phylogenetic
analyses (Crane 1985; Donoghue and Doyle 1989; Loconte and
Stevenson 1990, 1991; Nixon et al. 1994), and fossil evidence of

' Reprint requests should be addressed to MSZ.
143

144 Rhodora [Vol. 101

early angiosperms (Crane et al. 1994, 1995: Friis et al. 1994,
1995; Taylor and Hickey 1992) suggest that the morphological
features of the archetypical angiosperm flower are unresolved.
There is evidence to suggest that the diversification of angio-
sperms is associated with the diversification of the Apidae (Mich-
ener and Grimaldi 1988a, b; Crepet 1984, 1996; Crepet et al.
1991). The first occurrence of angiosperms, however, significantly
predates the first occurrence of bees in the fossil record (Laban-
deira and Sepkoski 1993). The importance of the Diptera as early
angiosperm pollinators has recently attracted attention (Kearns
1992; Kearns and Inouye 1993: Ren 1998). The Diptera have
their origin in the Late Triassic—Early Jurassic (Rohdendorf
1974), prior to the origin and the diversification of angiosperms.
Recent studies have shown that the floral foraging behavior of

partitus the bracts of the inflorescence produce a specialized high
lipid tissue (50% by dry weight) that the beetles consume along
with pollen (Beach 1982). Taxa that are unequivocally beetle pol-
linated frequently have floral modifications that specifically influ-
ence beetle behavior in the flower or inflorescence.

Despite a diversity of insect groups reported to visit Magnolia,
most investigators have focused on the occurrence of beetles in
the flowers of Magnolia, and on their role in pollen transfer (Bak-

with the floral behavior of the beetles.
urposes of this study are as follows: a) to examine the
floral characteristics that may function as insect attractants and/

1999] Allain et al.—Reproductive Biology of Magnolia 145

or rewards, i.e., UV reflectance of floral parts, nectar secretion
and composition, pollen availability, and the origin and longevity
of the floral fragrance; b) to determine the self- and cross-com-
patibility of the flowers during anthesis and how this may relate
to floral characteristics that are pollinator attractants and rewards;
and c) to determine the kinds, numbers, and pollen loads of the
various floral visitors, their behavior in the flowers of Magnolia
grandifiora, and how this behavior may be related to floral char-
acteristics that function as pollinator attractants and rewards.

MATERIALS AND METHODS

The investigation was carried out at three localities in south
Louisiana. Site #1 consisted of 59 cultivated trees located
throughout the city of Lafayette, Louisiana, a suburban habitat.
Site #2 was a single tree in the Louisiana State Arboretum, lo-
cated in Evangeline Parish, Louisiana. The 121.41 hectare arbo-
retum is a secondary growth forest that is 75-80 years old. The
tree at Site #2 was used for observing pollinators in the forest
canopy. Access to the 30—40 m forest canopy was achieved using
mountain climbing techniques (Perry 1978). Site #3 consisted of
a monoculture of over 30 trees of varying ages at the Louisiana
Nursery, Opelousas, Louisiana. The nursery is located in a rural
area and the trees were grown under horticultural conditions.

Pollinator attractants and rewards. To determine UV re-
flectance, flowers were photographed with a 35 mm camera using
a Kodak Wratten UV Filter No. 18A. This filter transmits long
wave UV radiation (320—400 nanometers). High speed (ASA
400) T-Max 400 professional black and white film was used to
record the reflectance patterns.

The origin of the floral fragrance was determined by dividing
the flower into separate parts (gynoecium, androphore, upper pet-
als, and lower petals) and placing the separated floral organs in
sterilized glass jars for 20 minutes. Thirty volunteers rated each
of the floral parts according to the intensity of the odor (0 being
the least and 5 being the most fragrant).

The flowers used for hand pollinations (see below) were mon-
itored for the presence of a stigmatic exudate (nectar) over the
four-day flowering period. The nectar used in the sugar analysis
was collected from first-day flowers from a variety of plants at

146 Rhodora [Vol. 101

Site #1 by using capillary tubes. (Nectar production ceased after
the first day of anthesis.) The nectar was immediately placed in
a cooler with ice packs, transported to the lab, and refrigerated
at 1°C. The nectar was run on 20 X 20 cm EM Reagent, Silica
Gel 60 Type plates. The gel thickness was 0.25 mm. After the
plates were spotted, the sugars were run over 15 cm with one or
two ascents, against ten sugar standards of various dilutions of a
15% (w/v) stock solution. The standards included glucose, man-
nose, fructose, galactose, xylose, ribose, rhamnose, sucrose, malt-
ose, and mannitol. The solvent used was a 9:6:3:1 solution of n-
butanol: acetic acid: chloroform: water. The plates were devel-
oped at 100—110°C for 10-20 minutes after being sprayed with
a 1:3 (v/v) solution of sulfuric acid: methanol. The presence or
absence of protein in the nectar was determined by the application
of 2% ninhydrin in acetone (w/v) to nectars spotted on a Thin
Layer Chromotography (TLC) plate and then baked at 100°C.

€ mean number of pollen grains per flower was estimated
by removing thirty stamens from three flowers collected from
three different trees at Site #1. Each of the thirty stamens was
agitated with 0.01% Tween 20 in a known volume of water. Pol-
len grains were counted on a hemacytometer grid. The mean
number of pollen grains per stamen and flower was calculated.
In addition, the number of ovules per flower was recorded to
derive an estimate of the pollen-ovule ratio (P/O).

Determination of self- and cross-compatibility. At Site #1,
flowers were hand pollinated to determine stigmatic receptivity
and cross- and self-compatibility. The pollinations were divided
among ten treatments, 14—39 plants per treatment. Four of the
treatments consisted of cross-pollinations on days 1—4 of anthesis,
four consisted of self-pollinations on days 1—4, one treatment was
an unpollinated bagged control for days 1—4, and one treatment
was an unbagged control for days 1—4, to determine the seed set
under natural conditions.

Prior to anthesis, the gynoecia of the hand pollinated flowers
were bagged with tubular nylon hosiery. After the hand pollina-
tions, the flowers were tagged. Pollen was collected for various
pollinations in paper envelopes. The pollen was stored at —10°C
with a desiccator (Williams 1980). To insure that all pollinations
from the stored pollen had a similar level of Viability, the duration
of pollen viability was tested. Flowers were collected from three

1999] Allain et al—Reproductive Biology of Magnolia 147

different trees during the first morning of anthesis, the petals were
removed, and the floral column with the stamens was placed on
a sheet of paper. Within 24 hr., the anthers dehisced, the floral
column was removed, one aliquot of pollen was stored at room
temperature (21°C), and one aliquot was stored at —10°C. Pollen
viability was tested from each of the aliquots daily for five con-
secutive days following anthesis using the method of Alexander
(1969).

The gynoecia were collected as they ripened and the number
of stigmas, the number of carpels setting seed, and the number
setting two seeds were recorded. The percentage of ovules fertil-
ized was calculated by dividing the total seed set by the total
number of ovules (2/carpel) and multiplying by 100. The per-
centage of ovules fertilized for the ten treatments was compared
using ANOVA (analysis of variance). A general linear model for
unbalanced designs was chosen and a two-factor general linear
model ANOVA was run on Minitab (Cruze and Weldon 1989).
The model was fitted with two main effects, crossed and selfed
treatments. The four days over which pollinations were made
were treated as an interactive factor with four levels. F-ratios were
compared at the 0.01 level of significance to detect differences
among treatments. Significant differences between treatments
were then tested using Tukey’s multiple-comparison (W) proce-
dure with Alpha = 0.05 (Cruze and Weldon 1989; Ott 1988).

Observations of insects. The types of insects and the number
of visits by each taxon at Sites #1, #2, and #3 were recorded by
direct observation or by videotape. Each of the three sites was
monitored 14 times at equally spaced intervals between May 19
and July 29. Insect visitor data were recorded for an average of
three hours per observation time, yielding a total of 42 hours of
observations per site. Unfamiliar insects were collected for iden-
tification and five individuals of each species were collected as
voucher specimens. All insects except thysanopterans were placed
in a kill jar containing ethyl acetate. Thysanopterans were fixed
in alcohol-glycerine-acetic acid (AGA) killing solution. After two
weeks in the AGA, the thysanopterans were dehydrated in an
alcohol series and mounted on microscope slides for identification
(Borror et al. 1989). For each site the number of visits by each
type of insect was recorded. The duration of the visits was re-
corded by direct observation and from time lapse and real-time

148 Rhodora [Vol. 101

videotaping of the flowers. The pollen load per individual of each
insect species was calculated as the mean number of grains car-
ried on the insect specimens collected. The pollen carried on the
corbicula of Apis mellifera was not available for stigmatic de-
position and so was not included in the pollen load of this species.
However, the pollen carried on the legs of halictid bees dislodged
easily and was available for stigmatic deposition; thus these pol-
len grains were included in the pollen load for this species.

The relative importance (RI) of various insect species as pol-
linators was calculated using the following equation:

ade <M)
where

RI, = Index of relative importance of pollinator i,
P; = Mean pollen load of pollinator i,
P = Sum of mean pollen loads of all insects,

V;, = Number of visits of pollinator i,

V = Total number of insect visits.

Overall or total RI was calculated for each taxon by using the
mean pollen load of the taxon over all three sites and the mean
number of visits by that taxon at all three sites. A correlation
coefficient was run on Minitab for all comparisons of insects
recorded at the three sites.

RESULTS

Pollinator attractants and rewards. On the first day of an-
thesis the stigmas strongly reflected UV light (Figure 1, 2). On
the second day of anthesis the stigmatic reflectance was evident,
but had significantly faded in comparison to the first day of an-
thesis (Figure 3). By the third day of anthesis the UV reflectance
of the stigmas was no longer evident. As the stigmatic reflectance
faded on the second day of anthesis, the androphore, from which
the stamens had abscised, reflected UV light in a checkered pat-
tern (Figure 3, 4). The reflectance of the androphore was evident
on the third day of anthesis, but was not detectable on the fourth

1999] Allain et al.—Reproductive Biology of Magnolia 149

Fig —4. The two stages in se grandiflora floral phenology.
t. pers photograph of a first day flower showing the reflective stigmatic
crests. 2. Photograph of a first day sige taken without the UV filter. 3.
Ultraviolet fortes of a second day flower showing the faded stigmas and
“checkered pattern” of the reflective nny (arrowhead). 4. Photograph
of a second day flower without the UV filt

day of anthesis. Throughout the four days of anthesis the corolla
strongly absorbed QZ

In the determination of the origin of the floral fragrance, 29 of
the 30 volunteers rated the petals most fragrant, and the andro-
phore least fragrant.

Nectar secretion associated with the stigmas occurred only on
the first day of anthesis. Nectar was not evident on days 2-4.
Using thin layer chromotography (TLC), three sugars were iden-
tified in the stigmatic exudate collected soon after the flowers
opened on the first day of anthesis; these were glucose, fructose,
and sucrose. Glucose and fructose, when visualized on the TLC
plates, showed a similar intensity to the 15% (w/v) standard sugar
solutions. Sucrose, although easily detectable, consistently exhib-

150 Rhodora [Vol. 101

ited less intensity, suggesting that lesser amounts of sucrose were
present in the stigmatic nectar than glucose and fructose. Nectar
collected 3—6 hr. after anthesis had no detectable sucrose, indi-
cating that as the nectar ages, the sucrose breaks down into hex-
ose sugars. Nectars are known to contain protein (Baker and Bak-
er 1975, 1983) and the nectar of Magnolia grandiflora tested
positive for protein.

On the second day of anthesis the stamens dehisced and sub-
sequently abscised from the androphore, falling into the cup-
shaped petals. It was in the cup-shaped petals that magnolia pol-
len was available in abundance. The estimated mean number of
pollen grains per flower was 58,000,000. The pollen-ovule ratio
was estimated to range from 207,000:1 to 520,000:1 with an av-
erage of 412,000:1.

Self- and cross-compatibility. To insure that differences in
seed set were not due to differences in pollen viability from day
to day, pollen was tested for viability. On the day of anther de-
hiscence (day 2 of anthesis) a mean of 94.5% of the pollen grains
were viable. There was no significant decrease in pollen viability
for the five consecutive days following anthesis when pollen was
stored at 21°C or —10°C.

Results of the hand pollinations showed that on the first day
of anthesis the stigmas were receptive to geitonogamous and xe-
nogamous pollinations. On the first day of anthesis the average
seed set for xenogamous pollinations was 55%. The average seed
set for geitonogamous pollinations was 38%, which was signifi-
cantly lower than the cross-pollinated flowers (Table 1). On the
second day of anthesis cross-pollinated flowers averaged 27%
seed set, on the third day 13% seed set, and on the fourth day
2% seed set, which was not significantly different from the

there was a significant decrease in percent seed set during the
second day of anthesis, i.e., from 38% On the first day, to 5% on
the second and third day of anthesis, and 3% on the fourth day
of anthesis (Table 1). Seed set on days 2, 3, and 4 in the self-
pollinated flowers was not significantly different from the unpol-
linated, bagged control. The unbagged, untreated control aver-

able 1. Mean seed set resulting from hand pollinations of Magnolia grandiflora flowers. Cells with different bold letters a, b,
c, d are - different at Alpha = 0.05. n = number of flowers/treatment; < = mean % seed set for each treatment; sd =

[6661

standard deviation

Treatments Day 1 Day 2 Day 3 Day 4
Cross n= 14 n= 16 n= 18 n= 14
¥ = 55 x = 27 x = 13 x=2
sd = 24 sd = 20 sd = 17 sd = 3
Self n = 20 n = 20 n= 12 n= 15
F = 38 ¥=5 x¥=5 x¥=3
sd = 24 sd = 11 sd = 15 sd = 4
Control n = 39
(bagged, unpollinated) kF=5
sd = 11
rol n = 20
(unbagged, untreated) ¥ = 34
sd = 26

pyousvp jo ASo[org aanonpoiday— Te 9 uleyTy

152 Rhodora [Vol. 101

aged 34% seed set, which is assumed to approximate seed set
under natural conditions.

The results of the hand pollinations in the cross-pollinated
flowers showed that from day 1 to day 4 there was a stepwise
reduction in receptivity. Each day was significantly less receptive
than the previous day, culminating on day 4, which was not sig-
nificantly different from the unpollinated, bagged control. The
flowers were self-compatible on the first day of anthesis and seed
set in the self-pollinated flowers was similar to the percent seed
set in the unbagged, untreated control. However, on the second,
third, and fourth days of anthesis, self-pollinated seed set was not
significantly different from the unpollinated, bagged control, in-
dicating that the flower was essentially self-incompatible after the
first day of anthesis.

Observations of insects. Seven orders of insects accounted
for more than 99% of the insect visits to Magnolia flowers at all
three sites. The correlation coefficient for all comparisons of the
insects recorded at the three sites was greater than 0.93, indicating
that the types of insects at each site, and the relative proportions
of the insects visiting Magnolia at each site were similar. Fre-
quencies of visits by the various insects varied among the sites,
with Site #2 having almost twice as many insect visitors as Sites
#1 and #3 over a similar time interval.

The Hymenoptera were the most frequent visitors of Magnolia
grandiflora and carried the most pollen (Table 2, 3). Two species
of ants belonging to the Formicidae accounted for 35 visits. The
most common of these two ant species carried no pollen. The

1999] Allain et al_—Reproductive Biology of Magnolia 153

Table 2. Number of insects per family visiting Magnolia grandiflora at
each site, and combined over all sites. The number of visits per taxon are for
the total 42 hr. of observations at each site. ‘Combined visits over all sites
as a % of the total number of insect visits for all taxa.

Number of Insect Visits

%
Insect Taxon Site #1 Site #2 Site #3 Combined of Total!
HYMENOPTERA

Apidae 433 1,049 560 2,042 70.7
Halictidae 19 38 1 58 2.0
er 36 8 0 44 1.5
TOTAL 488 1,095 561 2,144 74.2
COLEOPTERA
thari 2 29 ip 38 IBS:
Curculionidae 90 0 62 15zZ 53
Dermestidae 0 29 29 1.0
Mordellidae 41 32 3 76 2.6
Other 1 Fi 10 18 0.6
TOTAL 134 97 82 313 10.8
THYSANOPTERA
Thripidae 166 198 3 367 12.9
ALL OTHER
ORDERS 20 25 12 64 pe.

other species had an average pollen load of 2.75 grains each. At
Site #1 five cuckoo bees (Apidae, Tribe Epeolini; absent from
Sites #2 and #3) were collected, but no pollen was present. Two
carpenter bees (Xylocopa virginica) visited flowers in the forest
canopy at Site #2 and a single carpenter bee was observed at Site
#1, and had a pollen load of 1350 pollen grains. The honey bee
(Apis mellifera) dominated the floral fauna with an estimated
2042 visits out of 2888 recorded insect visits over the course of
the field study. As many as ten honey bees were in a single flower
at a time. Honey bees were most active in late morning to early
afternoon. Honeybees averaged about 34 visits/hour as deter-
mined from videotaped flowers at Sites #2 and #3. The mean
pollen load of A. mellifera (excluding the corbiculae) was esti-
mated to be 22,200 pollen grains each (n = 4). The corbiculae
were estimated to hold 73,000 pollen grains each (n = 4). A
single species of solitary bee of the Andrenidae was collected six
times at Site #2 and was found to carry a mean pollen load of
8300 pollen grains (n = 3). Andrenid bees were absent from Sites

154 Rhodora (Vol. 101

Table 3. Statistical description of Magnolia pollen grains carried per
sect. Taxa with less than 0.01% of total are excluded. 'Standard error. "Percent
of the total mean pollen load of all taxa combined. *Excluding pollen con-
tained in the corbiculae. *No standard error due to sample size.

Insect Taxon n Mean SE! % of Total?

HYMENOPTERA

Andrena vicina 3 8,333 1,816.30 17.10

Apis mellifera* - 22,200 7,598 45.60

Lasioglossum bruneri 3 16,250 2,602.10 33.40

Unidentified Formicidae 4 3 60 0.01

Xylocopa 1 1,351 - 2.78
COLEOPTERA

antharidae 5 97 39,30 0.20

Chrysomelidae - 265 228.60 0.60

Curculionidae 5 26 10 0.05

Dermestidae 5 8 2.40 0.02

Mordellidae 5 23 7.60 0.05

Unidentified 3 oy 7.30 0.02

IPTERA

Unidentified 10 2 1.20 0.01
HEMIPTERA

Pyrrhocoridae 1 64 is 0.10
HOMOPTERA

Cicadellidae 3 8 1.80 0.02

#1 and #3. The solitary halictid bee, Lasioglossum bruneri, was
present at all three sites, with 19 individuals collected at Site #1,
38 at Site #2, and | at Site #3. These bees carried a mean pollen
load of 16,300 grains (n = 3; excluding the corbiculae). A cor-
bicula was found to carry approximately 44,300 grains (n = 1).

Thysanopterans were present at all three sites. At Site #1,
20.4% and at Site #2, 13.9% of all insects collected were thrips.
Initially thrips were not noticed at Site #3, however thrips were
later collected from preserved flowers. The Thysanoptera were
too numerous and small to count in the field and were collected
from preserved flowers at the end of the field season. The number
of thrips does not represent the abundance of these insects over
the entire study period. The 400-500 ym thrips collected from
day 1 flowers (female phase) had pollen grains adhering to their
bodies, suggesting that thrips do transfer pollen from flower to

1999} Allain et al.—Reproductive Biology of Magnolia 155

Table 4. Relative importance (RI) of pollinators by family apie
using all insects). Families with an overall pollinator RI less than 0.01
excluded

Relative Importance of Pollinators

Insect Taxon Site #1 Site #2 Site #3 Overall
HYMENOPTERA
Apidae O77 98.01 99.87 98.45
Andrenidae 0 0.11 0 0.06
Halictidae 2.28 1.87 0.09 1.47
COLEOPTERA
Chrysomelidae 0.01 0.01 0.04 0.02

flower. Despite their high abundance, thrips carried an average of
0.3 pollen grains each

The highest number and relative abundance of coleopterans
was found at Site #1 on cultivated trees in the suburban habitat.
One of the most common beetles was the recently introduced
magnolia beetle, Odontopus calceatus. This species was also re-

Table 5. Relative importance (RI) of pollinators by family (calculated
with Apis mellifera and Odontopus calceatus excluded). Families with an
overall RI less than 0.01 are excluded.

Relative Importance of Pollinators

Insect Taxon Site #1 Site #2 Site #3 Overall

HYMENOPTERA

Andrenidae 0 5.36 0) 3:55

Halictidae 98.98 93.66 69.74 94.77

Xylocopa O15 0.14 0 0.14
COLEOPTERA

Canthari 0.01 0.06 0.39 0.05

Chrysomelidae 0.55 0.52 29.41 2h

Dermestidae 0 0.06 0 0.04

Mordellidae 0.27 0.15 0.40 O19
DIPTERA

Diptera/Other 0 0.01 0.01 0.01
HEMIPTERA

Pyrrhocoridae 0 0.03 0 0.02
THYSANOPTERA

Thripidae 0.02 0.01 0.01 0.02

156 Rhodora [Vol. 101

corded from Site #3, but was absent from the forest canopy (Site
#2). Magnolia beetles carried a mean pollen load of 26 grains (n
= 5). One species of Cantharidae was common at Site #2 and
carried the largest pollen load (an average of 97 grains, with a
maximum of 203 grains) of all the coleopterans collected. Mem-
bers of the Mordellidae occurred at all sites and were common
at Sites #1 and #2. A total of 41 individuals were collected at
Site #1, and 32 individuals at Site #2. Members of the Dermes-
tidae were collected at Site #2 and had an average pollen load of
8 grains. Beetles represented by a single individual were not iden-
tified. Coleopterans were observed to remain in flowers for long
periods of time, and many remained in the flower for the entire
time the flower was observed (up to 24 hr.). The random exam-
ination of over 400 flowers on the first day of anthesis (female
phase) resulted in the observation of two beetles, one member of
the Cantharidae and one of the Lampyridae.

Dipterans were present at all sites although no one species was
most common. Dipterans were most abundant at Site #1 where
16 of 25 dipterans collected were Plecia nearctica (Bibionidae).
Other dipterans collected included three species of the Asilidae
and four unidentified taxa at Site #1. At Site #2 three species of
the Sciomyzidae and three unidentified species were collected. In
addition 16 other taxa were observed, but were not captured for
identification. Dipterans at Site #3 included two members of the
Phoridae, six species of the Bibionidae, and one unidentified spe-
cies. Of the dipterans collected, most carried no pollen and three
species carried five, seven, and eight grains, respectively.

Of the remaining insects collected, one plecopteran of the Per-
lidae was collected at Site #3, but carried no pollen. Four ho-
mopterans, all members of the Cicadellidae, were collected and
carried an average of 8 pollen grains/insect. Two species of he-
mipterans were collected; Nezara viridula was collected at Sites
#2 and #3 and carried no pollen, and Euryophthalmus succinctus
was collected from Site #2 and was carrying 64 pollen grains.

DISCUSSION

The flowers of Magnolia grandiflora exhibited interactions
among floral movements, pollinator attractants and rewards, and
stigmatic receptivity. On the first day of anthesis the flowers
opened early in the morning presenting the receptive stigmas (fe-

1999] Allain et al—Reproductive Biology of Magnolia 157

male phase). Concomitant with anthesis was a conspicuous stig-
matic nectar and a strong floral fragrance, which emanated from
the petals. Three sugars were identified in the stigmatic exudate.
Fresh nectar (nectar collected during the early morning) was com-
prised of glucose and fructose with a lesser amount of sucrose
(i.e., a hexose-dominated nectar; Baker and Baker 1975). Baker
and Baker (1975, 1983) have shown that hexose-dominated nec-
tars also contain measurable amounts of protein. The stigmatic
nectar of M. grandiflora tested positive for protein. Nectar that
had been exposed to air temperature for 3—6 hr. was comprised
of only glucose and fructose; the sucrose became undetectable
using thin layer chromotography. This suggests that the sucrose
may have been enzymatically broken down into hexose sugars as
the nectar aged. Baker and Baker (1975, 1983) have demonstrated
that hexose-dominated nectars are usually associated with the
dish-bow] flower morphology, and pollination by short-tongued
bees (e.g., honeybees and halictid bees) or flies. The reflectance
of UV light was particularly strong by the stigmas (Figure 1, 2).
The highly reflective stigmas occurred against a corolla that
strongly absorbed UV light (Figure 1, 2). The floral fragrance and
the highly reflective stigmas in combination with the hexose-
dominated stigmatic nectar are floral attractants that can poten-
tially direct pollinators to the receptive stigmas in first-day flow-
ers. First-day stigmas were receptive to geitonogamous and xe-
nogamous pollinations (Table 1). Based on our field observations
and videotape of floral visitors at all three sites during the first
day of anthesis, 88% of the honeybee (n = 366) and 96% of the
halictid bee (n = 23) landings were on the stigmas. The bees
spent an average of | minute 14 seconds (n = 44) in first-day
flowers. We interpret this bee behavior as a response to olfactory
(floral fragrance) and visual (UV reflectance of the stigmas) floral
cues that are associated with nectar as the reward. After 1500
hours on the first day of anthesis the flowers began to close, were
fully closed by 1900-2000 hours, and remained closed until the
early morning of the second day of anthesis.

On the second day of anthesis the flowers re-opened early in
the morning. At this time the anthers dehisced and then abscised
from the androphore throughout the day, falling into the cup-
shaped petals. The flowers remained open continuously for the
next 2—3 days. The floral fragrance remained detectable. The UV
reflectance of the stigmas had faded but was still detectable (com-

158 Rhodora [Vol. 101

pare Figure 1 with Figure 3), however, the reddish-purple an-
drophore strongly reflected UV light in a checkered pattern after
all of the stamens had abscised (Figure 3, 4), i.e., the conspicuous
UV reflectance had shifted from the stigmas to the androphore.
The stigmatic nectar was no longer evident, however, pollen was
now available in abundance. The estimate of the mean number
of pollen grains per flower was approximately 58,000,000. It ap-
pears that the pollinator reward had also shifted from nectar to
pollen (Yasukawa et al. 1992). The pollen/ovule ratio (P/O) was
calculated for three flowers from three different trees. The P/O
averaged 412,000:1. The high P/O is not consistent with the oc-
currence of constant pollinators and suggests pollen limitation
(Cruden 1977; Cruden and Miller-Ward 1983). However, in Mag-
nolia the pollen was not presented while the stamens were at-
tached to the androphore, but on the cup-shaped petals after they
had abscised. There was frequent loss of pollen-laden stamens
due to disturbance of the flowers (e.g. by wind). The high P/O
may compensate for the losses due to this unusual type of pollen
presentation. Stigmatic receptivity remained high for cross-pol-
lination, however, self-compatibility was greatly reduced (Table
1). There was no Significant difference in seed set between the
bagged unpollinated control and the self-pollinated flowers on the
second day of anthesis. Seed set in cross-pollinated ovules was
lower than cross-pollinated ovules on the first day, but was sig-
nificantly higher than the self-pollinated ovules on the second day
of anthesis (Table 1). The shift in pollinator attractants and reward
on the second day suggests that a concomitant shift in pollinator
behavior in the flower should also occur. Based on our observa-
tion and videotape of pollinators at all three sites on the second
day of anthesis, 62% of the honeybee (n = 282) and 71% of the
halictid bee (n = 7) landings were on the reddish-purple andro-
Phore, the bees then made a 180° turn and began to forage for
pollen on the abscised stamens held in the cup-shaped petals.
Once in the cup-shaped petals, the bees often held the stamens

1999] Allain et al.—Reproductive Biology of Magnolia 159

On the third day of anthesis floral fragrance was still evident,
but had faded dramatically and the stigmas no longer reflected
UV light. The flower was still cross-compatible (Table 1), how-
ever receptivity was reduced further, though it was still signifi-
cantly higher than the bagged, unpollinated control. The behavior
of the hymenopteran floral visitors was similar to the behavior
observed in second-day flowers.

On the fourth day of anthesis floral fragrance and UV reflec-
tance were no longer evident and the flower was no longer re-
ceptive. In addition, a majority of the stamens (and hence the
pollen) had been lost from the wilting, cup-shaped petals. The
number of hymenopteran visits also dropped off dramatically.

In our observations at all three sites (including videotape taken
at Sites #2 and #3), hymenopterans were the only floral visitors
whose behavior showed any correlation with the array of floral
changes that occurred over the 4-day period in the flowers of
Magnolia grandiflora. It is expected from our investigation of
floral movements, stigmatic receptivity, and the pollinator attrac-
tants and rewards, that hymenopterans play an important role in
the pollination of Magnolia.

Based on our observation of floral visitors at all three sites, the
most frequent visitors of Magnolia grandiflora were hymenop-
terans (bees; Table 2). Coleopterans are considered the primary
pollinators of various magnoliid genera and species of Magnolia

aker and Hurd 1968; Delpino 1875; Dieringer and Espinosa
1994; Gibbs et al. 1977; Heiser 1962; Kikuzawa and Mizui 1990;
Leppik 1975; Thien 1974). In this study beetles accounted for
10.8% of all insect visits. Beetles consistently carried far less
pollen than the bees, and frequently carried pollen of other spe-
cies (Table 3). The hymenopterans in this study comprised 74.2%
of the total insect fauna observed on Magnolia flowers. Apis mel-
lifera outnumbered other insect visitors and accounted for 70.7%
of all insect visits. Honey bees are not indigenous to North Amer-
ica; however, they were attracted to the flowers of M. grandiflora
and were capable of pollinating the flowers. This suggests that
their behavior is similar to the native pollinators. At all three sites,
native Lasioglossum bruneri were second only to honeybees in
relative importance and thus may be a common natural pollinator
of M. grandiflora (Table 4, 5).

Beetles were floral visitors and carried pollen. They may have
transferred pollen by a “‘mess and soil’’ pollination syndrome.

160 Rhodora [Vol. 101

Bees, however, were frequent floral visitors and carried large
amounts of pollen. Bees were the only pollinators that exhibited
behavior in the flowers that was associated with the changes in
sex expression, stigmatic receptivity, and changes in pollinator
attractants and rewards over the flowering period. The changes in
sex expression, stigmatic receptivity, shifts in UV reflectance of
floral parts, and pollinator rewards, coupled with the influence
these changes had on the behavior of the hymenopteran visitors
in the flowers, suggests that despite its size and its presumed
archaic flower morphology, Magnolia has evolved specialized flo-
ral features that effectively influence the foraging behavior of
more specialized pollinators (i.e., bees).

ACKNOWLEDGMENTS. We would like to thank Tim Hebert of
the Louisiana Arboretum for his assistance in the field. We thank
Dr. Mark Smith for assistance in the field and with the Statistical
analysis. We thank Dr. Doug Yanega of the Illinois Natural His-
tory Survey for identifying the unknown bees. This project was
partially supported by the Louisiana Education Quality Support
Fund grant RD-A-33 to MSZ.

LITERATURE CITED
ALEXANDER, M. P. 1969. Differential Staining of aborted and non-aborted

pollen. Stain Technol. 44: 117~122
ARBER, E. A. N. AND J. PARKIN. 1907. On the origin of angiosperms. J. Linn.
0

AND ; a

linator type, pp. 117-141. In: C. E. Jones and R. J. Little, eds., Handbook

of Experimental Pollination Biology. Van Nostrand-Reinhold, Prince-

ton, NJ.

AND P. D. Hurp. 1968. Intrafloral ecology. Ann. Rev. Entomol. 13:
385-414.

Beach, J. H. 1982. Beetle pollination of Cyclanthus bipartitus (Cyclantha-
ceae). Amer. J. Bot. 69: 1074-1081.

BERNHARDT, P. AND L. B. THIEN. 1987. Self-isolation and insect pollination
in the primitive angiosperms: New evaluations of older hypotheses. PI.
Syst. Evol. 156: 159-176.

1999] Allain et al.—Reproductive Biology of Magnolia 161

BESSEY, v4 E. saps Phylogeny and taxonomy of the angiosperms. Bot. Gaz.
24: 145-1

5 LYIS. wi ei leh apis taxonomy of flowering plants. Ann. Missouri
t. Gard. 2: —164.
are D.€: - IPLEHORN, AND N. E JOHNSON. 1989. An Introduction
to the Study of Seno Saunders College Publ., Philadelphia, PA
CANRIGHT, J. E. 1952. The comparative morphology and relations of the Mag-
noliaceae. I. Trends of specialization in the stamens. Amer. J. Bot. 39:
484-497.
oe The comparative . and relations of the Magnoli-
acea . Amer. J. Bot. 47: —155.
CRANE, P R. 1985. nice analysis = seed plants and the origin of
angiosperms. Ann. Missouri Bot. Gard. 72: 716-793.
, E. M. Frits, AND K. R. PEDERSEN. 1994. Palaeobotanical evidence
on ‘the early radiation of magnoliid angiosperms. Pl. Syst. Evol., Suppl.
8: 51-72.

a AND ———. 1995. The origin and early diversification of
angios perms. Nature 374: 27-33.

CREPET, W. L. 1984. Advanced (constant) insect pollination mechanisms: Pat-
terns of evolution and implications vis-a-vis angiosperm diversity. Ann.
Missouri Bot. Gard. 71: 607-630.

. 1996. Timing in the evolution of derived floral characters: Upper
Cretaceous (Turonian) taxa with tricolpate and tricolpate derived pollen.
Rev. Palaeobot. Palynol. 90: 339-359.

——_—_E. Frus, AND K. C. Nixon. 1991. Fossil lesen for the evolution
of biotic pollination. Philos. Trans., Ser. B 333: 187-195.

sme aiang ey 1981. An Ripening System of pain OBI of Flowering

lant NY.

CRUDEN, R. W. 1977. adie ratios: A conservative indicator of breed-

ing systems in sans plants. Evebotion 31: 32-
AN ER-WARD. 1983. Pollen-ovule ratio, pollen size, and the

ratio of s fies a area to the pollen-bearing area of the pollinator: An
sh pensar’ eesceasins 35: 964-974.

CRUZE, E. Dy. Ww . 1989. Minitab Reference Manual. Data Tech In-
dustri mye) Valle ee Fee. PA

DELPINO, 5 1868-1875. Ulteriori ppeeriecorsany e arginine sulla sico-

nel regno vegetale. I-II. Atte. Soc. Ital. Sci. Nat. 11-12.

Reick G. AND J. E. Espinosa S. oa. Reproductive cera of Magnolia
schiedeana Mey ieee a threatened cloud forest tree species in Ve-
racruz, Mexico. feos Torrey Bot. Club 121: 154-159.

DONOGHUE, M. J. AND J. A. nit 1989. Phylogenetic studies of seed plants
and bestowed ial on morphological characters, pp. 181-193. In:
B. Fernholm, K. — and H. Jornwall, eds., The Hierarchy of Life.
Excerpta Medica, Amst

FAEGRI, K. AND L. VAN DER “a. 1979. The Principles of Pollination Ecology,

ess, N
Frus, E. M., K. R. PEDERSEN, AND P. R. CRANE. 1994. Angiosperm floral
structures from the Early Cretaceous of Portugal. Pl. Syst. Evol., Suppl.
8: 31-49.

162 Rhodora [Vol. 101

AND ———. 1995. Appomattoxia ancistrophora gen. et sp.
nov., a new Early Cretaceous plant with similarities to Circaester and
extant Magnoliidae. Amer. J. Bot. 82: 933-943.

Gisss, P. E., J. SEmirR, AND N. D. DA Cruz. 1977. Floral biology of Talauma
ovata St. Hil. (Magnoliaceae). Ci. & Cult. 29: 1436-1441.

HEISER, C. B. 1962. Some observations on pollination and compatibility in
Magnolia. Proc. Indiana Acad. Sci. 72: 259-266.

KEARNS, C. A. 1992. Anthophilous fly distribution across an elevation gra-
ae Amer. Midl. Naturalist 127: 172-182.

DD. ach INouYE. 1993. Pistil-packing flies. Nat. Hist. 102: 30-37.

Soe K. AND N. Mizu. 1990. Flowering and fruiting phenology of
Magnolia inpotenea Pl. Spec. Biol. 5: 255-261.
ues Cc: AND J. J. SEPKOSKI. 1993. Insect diversity in the fossil

record. oo 261: 310-315.

Leppik, E. E. 1975. Morphogenetic stagnation in the evolution of magnolia
flowers. Phytomorphology 25: 451—

LoconTE, H. AND D. W. STEVENSON. 1990. Cladistics of the Spermophyta.
cag 42: 197-211.

. 1991. Cladistics of Magnoliidae. Cladistics 7: 267-296.

Rea W. E. 1914. The development of Magnolia and Liriodendron, in-
ane a discussion of the primitiveness of the Magnoliaceae. Bot. Gaz.

: 1-31.

Micueen C. D. AND D. A. GrimaLpi. 1988a. A Trigona from Late Creta-
eous amber of es apt (Hymenoptera: Apidae: Meliponinae). Amer.

ri Novit. 2917:

on The oldest fossil bee: Apoid history, evolution-
ary stasis, and ‘he antiquity of social behavior. Proc. Natl. Acad. Sci.
U.S.A. 85: sae 6426.

Nixon, K. C., W. L. Crepet, D. A. STEVENSON, AND E. M. Fruits. 1994. A
reevaluation of seed plant phylogeny. Ann. Missouri Bot. Gard. 81: 484—
O33;

OTT, ie 1988. An Introduction to Statistical Methods and Data Analysis, 3rd
.. PWS-Kent Publishing Company, Boston, MA.

Hands D. R. 1978. A method of access into the crowns of emergent and
canopy trees. Biotropica 10: 155-157.

REN, D. 1998. Flower-associated Brachycera flies as fossil evidence for Ju-
rassic angiosperm origins. Science 280: 85-88.

ROHDENDORF, B. 1974. The Historical Development of Diptera. Univ. Alberta

Press, Alberta, C
ae oe W. AND L. J. HIckEY. 1992. Phylogenetic evidence for the her-
us origin of angiosperms. Pl. Syst. Evol. 180: 137-156.

THIEN, ies ‘B. 1974. Floral biology of Magnolia. Amer. J. Bot. 61: 1037-1045.

WILLIAMS, P. H. 1980. Bee-sticks, an aid in pollinating Cruciferae. Hort. Sci.
15: 802-803.

YASUKAWA, S., H. Kato, R. YAMAoKA, H. TANAKA, H. ARAI, AND S. KA-

RHODORA, Vol. 101, No. 906, pp. 163-199, 1999

THE TAXONOMY OF CAREX SECTION SCIRPINAE
(CYPERACEAE)

DEBRA A. DUNLOP
Biology Department, New England College, Henniker, NH 03242

GARRETT E. CROW

Department of Plant Biology, University of New Hampshire,
urham, NH 03824

ABSTRACT. Section Scirpinae, as treated herein, forms a cohesive group

bers of n = 31, and similar leaf anatomy, and possesses a high degree of
interfertility between subspecies based on hand-pollinations. Taxa in this sec-
tion are distributed primarily in North America. Taxonomic problems in the

have been related to the lack of a comprehensive monographic treat-

Based on evidence from a previous study using morphology, chromosome
numbers, leaf anatomy and surface structure, achene and perigynium micro-
morphology, interbreeding hese ecology, and distributions, five taxa

four subspecies (ssp. scirpoidea, convoluta, ssp. pseudoscirpoidea, and
ssp. stenochlaena), and C. curatorum. Two taxa, C. gigas and C. scabrius-
cula, have been excluded.

Key Words: hier ee Carex, Carex curatorum, Carex gigas, Carex sca-
iuscula, Carex section Scirpinae, Carex scirpoidea, Carex
paca ssp. scirpoidea, ssp. convoluta, ssp. pseudoscirpo-

idea, and ssp. stenochlaena; systematics, taxono

The taxonomic treatment of Carex section Scirpinae presented
here recognizes C. scirpoidea Michx. ssp. scirpoidea, ssp. con-
voluta (Kiikenthal) Dunlop, ssp. pseudoscirpoidea (Rydberg)
Dunlop, ssp. stenochlaena (Holm) Léve and Léve, and C. cura-
torum Stacey. The subspecies of C. scirpoidea are geoeraphically
based ecotypes that differ morphologically in only a few char-
acters. Two taxa, C. gigas (Holm) Mackenzie and C. scabriuscula
Mackenzie, previously assigned to the section, have been exc ud-
ed based on inconsistencies in characters that distinguish the sec-
tion (Dunlop 1990).

This taxonomic treatment is based on the results of a biosys-
tematic study of the section Scirpinae (Dunlop 1990). A detailed

163

164 Rhodora [Vol. 101

analysis of variation in characters focused on morphology, anat-
omy, achene and perigynium micromorphology, chromosome
number, ecology, breeding relationships, and distribution patterns.
Specimens were borrowed from 48 herbaria and collected from
30 field sites. At each field site, four to ten plants of each gender
were collected and grown in the University of New Hampshire
greenhouse for the chromosome analysis, breeding system obser-
vations, and crossing experiments. In addition, 17 analyses were
conducted on field-site soil samples.

Variation was assessed in a macromorphological study con-
sisting of 139 individuals using 69 qualitative and quantitative
characters. A numerical analysis was conducted on a subset of
these individuals using Principle Components Analysis.

Achene micromorphology was examined in 62 specimens, re-
sulting in distinctions at the specific level but not the subspecific
level (Dunlop 1990). In addition, micromorphological features of
42 perigynia were studied. Carex scirpoidea and C. curatorum
have hirsute to villous perigynia with long hairs distributed over
the entire adaxial and abaxial surfaces, or occasionally on the
upper one-half to two-thirds surface. This contrasts with C. gigas
and C. scabriuscula, which have sparsely pubescent perigynia
with short hairs on the top third of the perigynia.

Internal foliar anatomy and surface features were examined in
transverse sections and epidermal peels. The leaves of the sub-
species of Carex scirpoidea are anatomically indistinguishable
except for the very narrow, flanged, V-shaped leaves of ssp. con-
voluta. The presence of hairs on the adaxial leaf surfaces of C.
curatorum distinguish it from C. scirpoidea.

Thirty reliable chromosome counts were made from green-
house-grown plants; photographic vouchers are presented in Dun-
lop (1990). The subspecies of Carex scirpoidea have counts of n
= 31, whereas C. gigas and C. scabriuscula have counts of n =
29. Based on the reported aneuploid series in Carex, it would not
be unexpected to find n = 29 as part of a series with n = ae.
Thus, this lower number alone would not be justification to ex-
clude the two previously mentioned taxa from the group. How-
ever, when correlated with morphological, anatomical, and eco-
logical data, chromosome data strengthen the evidence to remove
C. gigas and C. scabriuscula from the section (Dunlop 1990).

Observations on greenhouse-grown plants (Dunlop 1990) show
the dioecious breeding system to be stable in Carex scirpoidea

1999] Dunlop and Crow—Taxonomy of Carex 165

subspecies and C. curatorum. Slight variation occurs whereby
one to two staminate flowers may appear among the pistillate
flowers on a pistillate spike, or one to three pistillate flowers may
occur at the base of a staminate spike or in the axil of the in-
volucral bract. The breeding system of C. gigas and C. scabrius-
cula is more variable as plants may often possess small androg-
ynous spikes.

Interbreeding relationships were examined using experimental
hand-crosses with greenhouse-grown plants. Subspecies of Carex
scirpoidea, although rarely sympatric, are highly interfertile in
the greenhouse (Dunlop 1990).

TAXONOMIC HISTORY

Tuckerman (1843) first applied the epithet Scirpinae to one of
nine groups of sedges of unspecified rank under section Psyllo-
phorae. He distinguished the Scirpinae as a group of plants that
were almost always dioecious with red-brown, pubescent peri-
gynia. His concept of the Scirpinae included C. scirpoidea (= C.
scirpina Tuckerman) and C. drummondiana Dew. Later, in a treat-
ment of North American carices, Bailey (1887) took a broad view
and assigned C. scirpoidea to section Sphaeridiophorae Drejer,
which included subsections Filifolia Tuckerman and Montanae
Fries. In the same year, Pax (1887) placed C. scirpoidea in section
Dioicae Fries in subsection Scirpoideae. Kiikenthal (1909) adopt-
ed Tuckerman’s concept of the Scirpinae group, excluded C.
drummondiana, and established section Scirpinae in subgenus
Primocarex. The sectional name is validly published by Kiiken-

al.

The subgeneric placement of the section Scirpinae has varied
depending on an author’s view of whether the unispicate condi-
tion was primitive or derived, or of the evolutionary significance
of certain characters (Krechetowich 1935; Kiikenthal 1909; Nel-
mes 1951: Reznicek 1990). Kiikenthal (1909) placed the section
in subgenus Primocarex, as he viewed the en ae condition
as primitive. In a thorough discussion, Reznicek (1990) summa-
rizes the subgeneric history of Carex and, as generally agreed,
recognizes three subgenera: Carex, Indocarex, and Vignea. Sub-
genus Primocarex is considered artificial and therefore not rec-
ognized due to the heterogeneity of the unispicate Carex. Rela-
tionships of section Scirpinae to other sections remains uncertain.

166 Rhodora [Vol. 101

Since 1803, when Michaux described Carex scirpoidea, the
taxon on which the section is based, nine additional taxa have
been recognized by various authors. Rydberg (1900) recognized
C. pseudoscirpoidea Rydb. as a distinct species differing from
eastern C. scirpoidea in being more robust plants with scales
shorter than the perigynia. Then, Holm (1904) described two new
varieties of C. scirpoidea: var. stenochlaena Holm and var. gigas
Holm. Two additional taxa, C. scabriuscula Mack. and C. scir-
piformis Mack., were recognized and described by Mackenzie
(1908) in a treatment of C. scirpoidea and allies. Kiikenthal
(1909) recognized two additional varieties of C. scirpoidea, vat.
convoluta Kiik. and var. europaea Kiik. Later, Stacey (1937) de-
scribed C. curatorum Stacey, and Hermann (1957) described C.
athabascensis Hermann.

All but two of the above mentioned taxa (Carex athabascensis
and C. scabriuscula) have been treated by different authors at the
specific level or as varieties of C. scirpoidea. In his worldwide
monograph, Kiikenthal (1909) took a narrow view of the section
and recognized only one species with five infraspecific taxa (var.
Scirpoidea, vat. europaea, var. convoluta, vat. stenochlaena, and
var. gigas). In contrast, in a treatment of North American carices,
Mackenzie (1935) recognized six distinct species.

In addition to differing taxonomic viewpoints, various inter-
pretations in terminology, primarily in the use of the words aphyl-
lopodic and phyllopodic, have further complicated our under-
Standing of the systematics of this group. Furthermore, species
descriptions have been based primarily on pistillate plants; sta-
minate material often had not been described, nor even observed,
for some taxa. Until this study, patterns of variation in morpho-
logical characters had not been described across the full geo-
graphic range, and information on endemic taxa was sparse.

TAXONOMIC CRITERIA
This study follows the criteria and definitions of species and

infraspecific taxa outlined by Standley (1985) and Crins and Ball
(1989) for Carex. Species are defined as groups of populations

1999] Dunlop and Crow—Taxonomy of Carex 167

isolated through either genetic incompatibilities, geographic or
onesie isolation, or differences in phenology.

of subspecies has been applied here to the well-defined
ates of the wide-ranging Carex scirpoidea. Each subspecies is
distinguished by vegetative or reproductive characters, a distinct
distribution, and a unique habitat. Four subspecies are recognized,
two of which have been designated recently (Dunlop 1997).

TAXONOMIC TREATMENT

Carex L. section Scirpinae (Tuckerm.) Kiikenthal in Engler,
Pflanzenreich 38 (IV:20): 81. 1909. TyPE: Carex scirpoidea
Michx. Scirpinae Tuckerman, Enum. Meth. Caricum Qua-
runum, 1843. Scirpoideae Pax in Engler and Prantl, Nat.
Pflanzenfamilien 2(2): 123. 1887, as subsection. Trysanolepis
V. Krecz. in Komarov, Flora of the USSR 3: 243. 1935.

Cespitose perennials with red-brown, lignescent roots. Rhi-
zomes either short or elongate with internodes 1—2 cm long.
Culms arising from current year shoots (lacking the withered per-
sistent leaf bases of the previous year) or from shoots of the
previous year, triangular, scabrous on the angles, height exceeding
the length of the leaves. Pistillate culms 5—94 cm tall. Staminate
culms 3-74 cm tall. Leaves of the rhizome and culm base reduced
to sheaths, lacking blades. Leaves of the flowering shoot attenu-
ate, adaxial surface glabrous or pubescent, scabrous with marginal
prickles. Vegetative leaves similar to leaves of the flowering
shoot; mouth of the leaf sheaths concave, entire to erose; sheath
front membranous, scabrous, white to tan; dorsal surfaces coria-
ceous, glabrous, pale green to red-brown; ligules semicircular to
triangular, tan to red-brown, ciliate. Inflorescences unisexual,
rarely bisexual, then only with few staminate flowers interspersed
in the pistillate spike or 1-2 perigynia in the axils of the invo-
lucral bract at the base of a staminate spike. Inflorescences unispi-
cate, very rarely with a small lateral sessile spike of the same
sex, erect or on lax culms, linear to clavate, densely flowered to
loosely-flowered at the base. Involucral bracts usually present,
sometimes single, foliaceous or scale-like, shorter than or equal
to the inflorescence, attenuate, inserted below spike. Perigynia
ovate to lanceolate, narrower than, equal to or as wide as the
subtending scale, tightly or loosely enveloping the achene, pale

168 Rhodora [Vol. 101

green, tawny, red-brown to purple-black, hirsute to villose with
white-golden brown hairs. Achenes brown, trigonous, 1—2.5 mm
long, 0.8-1.5 mm wide, rarely with a short stipe, filling the full
length and width of the perigynia or filling only one % to % the
length and width. Stigmas 3. Rachilla absent or present. Anthers
1.5-3.5 mm long. Chromosome n = 31.

KEY TO CAREX SECTION SCIRPINAE

1. Achenes not filling the full length or width of the perigynia,
occupying % the width of the perigynia such that the sides
of the perigynia are compressed; adaxial leaf surfaces
sparsely pilose with fine white hairs; plants of low ele-
vations in n. Arizona and s. Utah...... 2. C. curatorum

1. Achenes filling the perigynia or at least all but the upper %;

adaxial leaf surfaces glabrous; plants widely distributed
especially in calcareous soils in arctic and alpine habitats,
often on chifs and Jedges =... 2006. sis eed es (2)
2. Culms arising from shoots of the previous year such that
withered leaf bases of the previous year persist, sheath-

ing the base of the culm; scale leaves absent at the base

of the culm; leaves of the flowering shoot clustered,
diverging from one region of the shoot axis ca. 10-20
WIR AUOVE Che CIZOME | ee 3 ks ia des. 2
Pieeue uw ws lb. C. scirpoidea ssp. pseudoscirpoidea

2. Culms arising from shoots of the current year, lacking with-
ered leaf bases from the previous year; scale leaves
present, conspicuous at base of the culm, red-brown
(anthocyanic); leaves of the flowering shoot diverging
from intervals scattered along the shoot axis .... (3)

3. Perigynia lanceolate to oblanceolate, (2.8) 3—4 (5) mm
long, greater than 2.5 times as long as wide; culms
usually lax causing the spikes to droop .......

eee ae 1d. C. scirpoidea ssp. stenochlaena

x ee ovate to obovate, (1.8) 2—2.5 (3) long, less
n 2.5 times as long as wide; culms stiff, spikes

OrOct 0:06 Sas Sa, aes. ee ais: 4)

4. Widest leaves of the flowering culm of pistillate

plants more than 1.5 mm wide, leaves flat or

widely V-shaped in cross-section ..........
eee la. C. scirpoidea ssp. scirpoidea

1999] Dunlop and Crow—Taxonomy of Carex 169

4. Widest leaves of the flowering culm of pistillate
plants less than 1.5 mm wide, leaves mostly con-
volute or narrowly V-shaped in cross-section ..
«Cite Sa lc. C. scirpoidea ssp. convoluta

1. Carex scirpoidea Michx. Fl. Bor. Am. 2: 271. 1803.

la. Carex scirpoidea Michx. ssp. scirpoidea, C. michauxii

chwein., Ann. Lyceum Nat. Hist. N.Y. 1: 64. 1824 (based

on C. scirpoidea). C. scirpina saoculta, Enum. Meth. Car-

icum Quarundum 8. 1843 (spelling change, based on C. scir-

poidea). TYPE: CANADA. Boreal regions, Michaux s.n. (HO-
LOTYPE: P, microfiche P!, photo MT!).

C. wormskiolidiana Hornemann, Fl. Dan. 9: 6 pl. 1528. 1816. Type:
AND. Mallenefield (Plate 1528).
C. scirpoidea forma basigyna Lange, Consp. Fl. Groenl. ed. 2:132.
1890. Type: not known.
C. scirpoidea var. europaea Kiikenthal, in Engler, Pflanzenreich 38 (IV:
20): 81. 1909. Type: NoRWAY. Solvagtind, Kneuker 181 (not seen).
C. scirpiformis Mackenzie, Bull. Torrey Bot. Club 35: 270. 1908. C.
scirpoidea var. scirpiformis (Mackenzie) O’ Neill & Duman, Rho-
dora 43: 417. 1941. Type: CANADA. Alberta: Banff, damp ground
near Middle Spring, 28 Jun 1899, McCalla 2348 (HOLOTYPE: NY!;
ISOTYPE: CU! WTU!).
| athabascensis Hermann, Leafl. W. Bot. 8: 111. 1957. TYPE: CANADA.
rta: Jasper National Park, on mossy rocky shelf on marl upper
shore of Athabaska River above Athabaska Falls, alt. 3800 ft., 20
miles southeast of Jasper, 28 Aug 1956, Hermann 13498 (HOLO-
TYPE: US!; ISOTYPES: ALTA!, CAN!, MICH!, NA

Rhizomes short and creeping. Culms one to several per node,
arising from current year shoots (lacking the withered persistent
leaf bases of the previous year), scabrous especially at apex. Pis-
tillate culms 0.3—-1 mm wide at top, (0.6) 0.8—1.7 mm at base, (5)
10-35 (40) cm tall. Staminate culms 0.5—1 mm wide at the top,
0.8-1.4 mm at base, (3) 9-14 (26) cm tall. Leaf sheaths of the
rhizome and the culm bases red-brown to brown-black, glabrous,
shiny, coriaceous. Leaves of the flowering shoots 2—5, not clustered
along the stem, adaxial surface glabrous, margins scabrous espe-
cially towards apex; in pistillate plants (3.5) 11-20 cm long, 1.5—
3 (3.4) mm wide; in staminate plants 8-25 cm long, 0.8-2.6 mm
wide. Vegetative leaves 5—8 per shoot; in pistillate plants (5) 13—
24 (31) cm long, (1.1) 1.5—2.5 (2.7) mm wide; in staminate plants
8-25 cm long, 0.8-2.6 mm wide; ligules semicircular, (0.5) 1-2

170 Rhodora [Vol. 101

(2.3) mm in height, 0.2-0.4 mm wide. Inflorescences unisexual,
unispicate, (very rarely with a short sessile lateral spike of the same
sex), erect, linear, densely flowered; pistillate spikes (7.5) 10-30
(37) mm long, 3-5 mm wide; staminate spikes 10-25 mm long,
0.5—0.8 mm wide. Involucral bracts usually present, foliaceous or
scale-like, shorter than the inflorescence, 3.5-20 cm long, base
inserted 2.5—-17.5 mm below spike, auriculate. Pistillate scales
ovate, (1.5) 1.8—2.5 (2.9) mm long, 1—1.5 mm wide, shorter than,
equal to, or longer than the perigynia, apically acute to obtuse, red-
brown to brown-black with narrow to broad hyaline margins; cen-
tral midrib narrow, green-tawny to dark brown, shorter than or
extending to apex; margins entire, often ciliate. Staminate scales
similar to pistillate, 3.5—4.3 mm long, 1—1.3 mm wide. Perigynia
ovate, (1.8) 2-2.5 (3) mm long, (0.9) 1—1.2 (1.5) mm wide, as
wide as the subtending scale, abruptly contracted to a beak, gen-
erally lacking a short basal stipe, adaxial surface with few obscure
short nerves at base, marginal veins not evident, pale green to
tawny, becoming red-brown towards apex, hirsute to villose with
white hairs; body tightly enveloping the achene; beak 0.1-2 mm
long, red-brown and hyaline at tip, straight at maturity, orifice en-
tire and circular. Achenes dark brown, (1) 1.5—1.8 mm long, (0.6)
0.8-1.2 (1.5) mm wide, lacking a stipe, filling the perigynia or at
least %4 the length and width. Rachilla absent. Anthers 1.5—2.5 (3)
mm lon

DISTRIBUTION. Carex scirpoidea ssp. scirpoidea is the most
widely ranging taxon in section Scirpinae (Figure 1). This sub-
species is distributed across northern North America from Green-
land, Labrador, and Newfoundland west to the Northwest Terri-
tories and Alaska, south to northern New England, northern New
York, northern Ontario, northwestern Minnesota, North Dakota,
and in the mountains in Colorado, Utah, Nevada, Montana, Idaho,
Wyoming, eastern Oregon, and British Columbia. A number of
populations occur in Russia on the Kamchatka and Chukotskiy
Peninsulas. One disjunct population occurs on Solvagtind Moun-
tain in Norway.

HABITAT. Most often ssp. scirpoidea occurs on wet substrates
with a high level of calcium (2058 ppm. to 2.52%; Dunlop 1990).
In New England, ssp. scirpoidea occurs in widely scattered sites
where there is some influence from calcareous parent material,

Dunlop and Crow—Taxonomy of Carex 171

1999}

900

450 800-800 100000 | MILOMETERS

ry
LAMBERT AZIMUTHAL EQUAL-AREA PROJECTION

t = ne oe
20

Figure 1.

Distribution of Carex scirpoidea ssp. scirpoidea in North

America and Beringia.

$72 Rhodora [Vol. 101

and with associated calcicoles such as Potentilla fruticosa L. and
Juniperus horizontalis Moench. Based on observations in New-
foundland, ssp. scirpoidea grows on both calcareous and serpen-
tine substrates.

A specific location is not known for the type, as Michaux
(1803) cites the type locality for Carex scirpoidea as ‘“‘ad sinum
Hudsonis,”’ and a photo of the type shows a label bearing the
locality as “‘in borealibus Canadae.”’

Carex scirpoidea ssp. scirpoidea is the most widespread taxon
in this section and includes in synonymy a number of taxa for-
merly recognized by other caricologists. Kiikenthal recognized C.
Sscirpoidea var. europaea from a single disjunct locality in Nor-
way. Although these plants are short in stature, like typical plants
of C. scirpoidea ssp. scirpoidea from alpine habitats, values for
the morphological characters fall within the normal range for ssp.
scirpoidea, There appears to be no justification for distinct tax-
onomic recognition for this population.

Another taxon, Carex scirpiformis, had been recognized pre-
viously by Mackenzie (1908) and treated at the varietal rank by
O’ Neill and Duman (1941) based on wide, hyaline, pistillate scale
margins and light colored pubescence. In addition, Hermann
(1957) recognized C. athabascensis as a separate species based
on the overall robust habit and small, ovoid achenes. These mor-
phological characters of scale margins, pubescence, and size fall
into the range of variation for C. scirpoidea.

REPRESENTATIVE SPECIMENS: Canada. ALBERTA: Brazeau National Forest,
Whitehorse Creek, 26—28 Aug 1957, Porsild 20824 (CAN); Bow River near
Pilot Mt., 19 & 26 Jun 1945, Porsild & Breitung 12304 (CAN); Cline River,
on David Thompson Hwy., 27 mi. E of Jasper-Banff Park Boundary, 3 Jul

Russel 559367 (usas); Crystal Lake, 31 Jul 1953, Breitung 17007 (NA); Kan-
anaski i

Jul 1963, Mosquin & Benn 5206 (DAO, SASK); Laggan, 11 Jul 1904, Macoun
64054 (CAN); Kananaskis Road, 50°13'N, 114°32'W, 30 Aug 1964, Calder
37292 (DAO); Peyto Lake, 66 mi. N of Banff, 12 Jul 1941, Weber 2427 (can,
COLO, GH, WS, UBC); Quartz Ridge, 51°02'42’N, 115°46'10"W, 21 Aug 1972,
Hudson & Scotter 2789 (sask); Windy Point, 30 mi. W of Nordberg on the
David Thompson Hwy., 52°15’N, 116°23'W, 16 Jun 1974, Dumais 6810

(
dance pass near Sulfur Mt., 10 Aug 1954, Ledingham 1954 (UsAS); Jasper
National Park, Angel Glacier, Mt. Edith Cavell, 4 Aug 1941, Scamman 2428

1999] Dunlop and Crow—Taxonomy of Carex 173

(GH); Jasper National Park, Athabaska — Athabaska Falls, 20 mi. SE of
Jasper, Hermann 13498 (CAN, MICH); BRITISH COLUMBIA: Alaska Highway,
Summit Pass, foot Mt. St. George, ‘ties 302, 10 Aug 1962, Eastham 118/62
(UBC); Red Mt. W end Quiniscoe Lake, perlite 120°13’W, 4 Aug 1956,
Calder, Parmelee & Taylor 19782 (DAO, WTU, MIN); 24 mi. E of Golden,
Kicking Horse nies 25 May 1938, McCabe 6297 (CAS, UC); Banff-Win-

Road, ar Vermilion Crossing, il Jul 1944, McCalla 8429 (pao,

53°10’N, 119°11'W, 19 Aug 1956, Jenkins 7235 (DAO); Queen Charlotte le
land, Canoe Pass, 26 Jul 1910, Spreadborough 83090 (CAN); Spinel Lake,
57°50'N, 126°23'W, 4 Aug 1977, Gillett & Boudreau 17735 (CAN); nH
ah 56°3'N, (123°40'W, 16 Jul 1932, Raup & Abbe 3863 (CAN, F, GH,
us); Windermere, slopes Paradise Mine, 31 Jul 1953, Calder & Savile
1 1273 (pao); Yedhe Creek, near 58°33’'N, 125°23’'W, 10 Jul 1971, Annas s.n.
(DAO); Yoho National Park, Emerald Lake, 4 Jun 1947, McCall 959] (ALTA,
sane LABRADOR: Anchorstok Bay, 1934, Potter & Brierly s.n. (Us); Battle
Harbour, Rawson-MacMillan Expedition, 1927, Sewall 195 (GH, F); Cape
Mugford, 57°55'N, 61°55'W, 11 Aug 1939, Dutilly, ape & Duman s.n.
(DAO); Fraser Canyon, Lake Tasisuak, 100 km from N 10 Aug 1973,
Shepard & Matthews 82 (CAN); Gerin Mt., 55°04'N, 6r14'W, 21 Jul 1955,

58°15’ N. 62°40’ wW, 17 Jul, 1939, Oldenburg 38a (MIN); Hopedale, 55°27’ N.
60°12’W, 25 Jul 1928, Bishop 147 (CAN, GH); Knob Lake, Schefferville area,

Potter 7421 (wis), 16 Aug 1937, 7425 (wis); Torngate Region, Kangalak-
siorvik, 59°25'N, 63°40'W, 6 Aug 1931, Abbe 135 (CAN); Rowsell Harbor,
58°58'N, 63°15’'W, 20 Jul 1931, Abbe & Odell 133 (Gu); Windy Tickle, 18
Aug 1937, Walker 1126 MANITOBA: Brandon, 15 Jul 1951, Stevenson
366 (DAO); Cowan, 30 mi. E of Swan Lake, 12 Jul 1950, Scoggan & Baldwin

7966 (CAN); Hudson Bay, : Jun 1950, Brown 631 (NHA); Fort Churchill, 4
Aug 1948, Gillett 2392 (MAINE); Gillam, 21 Aug 1950, Schofield 1523 (CAs,
DAO, NY, WS); Ilford, 56°20'N, 95°60'W, Jul 1976, Sims 1108 (CAN); Lake
Winnipegosis, between Cedar Lake and Lake Winnipegosis, 17 Aug 1948,
Scoggan 4651 (CAN); Landing Lake, 23 Jul 1951, Irvine 761 (DAO); Moose-
horn, 110 mi. W of Winnipeg, 9 Jul 1951, Scoggan 9299 (CAN); Nelson River,
Gillam Island, about 15 mi. above Port Nelson, 30 Jul 1949, Scoggan 6267

wIc 00:
river oe to label), 15 Jun 1940, Chamberlain 1579 (MAINE, UC), NEW-
valon Pen., seers Bay, Topsail, 12-19 Aug 1901, Howe
Jul 1951, Rouleau 2072, 2074 (Dao,

on Rt. 460, 19 Aug 1986, Dunlop & Orlando 2473 (NHA); Bonne Bay, Shag
Cliff, 9 Aug 1929, Fernald, Long & Fogg 1404 (GH, MT, NY); Eagle’s Nest

174 Rhodora [Vol. 101

Brook, Mine Brook, York Harbor Mine, 12 Jul 1952, Rouleau 3064 (mt);
Eddie’s Cove, 28.4 mi. W of junct. Rt. 345 and new Rt. 430, 23 Aug 1986,
Dunlop & Orlando 2524 (NHA); Frenchman’s Cove, 19 Aug 1965, Rouleau
9946 (MT); 1 mi. W of Steady Brook, 19 Jul 1979, Hellquist & Crow 13555
(Bosc); Marble Mt., S side facing Humber River on Rt. 1, 19 Aug 1986,
Dunlop & Orlando 2480 (NHA); Point Ritchie, Porte aux Choix, Aug 1986,
Dunlop & Orlando 2510 (NHA); Green Island Cove, 23 Aug 1986, Dunlop
& Orlando 2522 (NHA); Table Mountain radar site, 4 km W, 18 Aug 1986,
Dunlop & Orlando 2440 (NHA); Winterhouse Brook, Dunlop & Orlando 2481

7089 (DAO); Burnside Harbour, 12 Aug 1944, Oldenburg 44-729 (min); Baffin
Island, Apex Hill, 63°45'N, 67°15’W, 7 Aug 1964, Swales s.n. (RM); Arctic

111, Bolstead Creek, 25 Jul 1944, Wynne-Edwards 8252 (CAN); Cape Dal-
housie, 70°13'N, 129°40’W, 31 Jul 1963, Cody 13137 (DAO); Cache Creek,

Island, 78°53'’N, 75°50’W, 14 Jul 1979, Gillett & Schepanek 18105 (coo);
Great Bear Lake, Sawmill Bay, Leith Peninsula, 15-16 Jul 1948, Shacklette
3032 (MICH, MT, US); Hudson Bay, Kugong Island, 56°11'N, 80°05’W, 29 Jun
1971, Manning s.n. (DAO), 5 Jul 1971, Manning s.n. (DAO), 7 Sep 1971 (pao);
James Bay, Solomons, Temple Island, 14 Jul 1949, Baldwin 1657a (MAINB),
1691 (MAINE, MICH); Jean-Marie River on Mackenzie Highway, 15 Jun 1973
Skogland 793 (sask); Coral Harbour, Munn Bay, 9 Aug 1948, Cody 1959
(mT); Munn Bay, 9 Aug 1948, Cody 1950 (NA); Murchison River, 67°46'’N

1999] Dunlop and Crow—-Taxonomy of Carex 175

National Park, 61°29’N, 109°28’W, 24 Jul 1976, Talbot 6110 (CAN); Mistake
Bay, 62°0S'N, 93°06’W, 20-29 Jul 1930, Porsild 5638 (CAN); Mt. Sidney,
Dobson, 26 Aug 1975, Scotter & Marsh 5665 (Sask); North Sleeper Island,
59°17'N, 80°40'W, 2 Sep 1939, Dutilly, O’Neill & Duman 87568 (MO); Nor-
man Wells, Bosworth Creek, 29 Jul 1953, Cody & Gutteridge 7660 (DAO, F,
GH); Rankin Inlet, 62°49'N, 92°05’W, 17 Jul 1973, Gillett 16067 (CAN); Vic-
toria Island, Cambridge Bay, 12 Aug 1959, Calder, Savile & Kukkonen 24152
(DAO); NOVA SCOTIA: Inverness Co., Corney Brook, 29 Aug 1956, Webster
633 (CAN, DAO, MT); LeBlanc Brook, Cheticamp River, 6 Jul 1953, Smith et
al. 7754 (MT), 28 Aug 1956, Webster 630 (CAN, DAO, MAINE); Victoria Co.,
Salmon River, Lockhart Brook, 8 Jul 1952, Smith et al. 6385 (DAO); Cape
Breton Co., North Sydney, Cape Breton, 13 Jul 1883, Macoun 31-835 (CAN);
ONTARIO: Cochrane District, Albany River, 51°13'N, 84°22’W, 7 Aug 1960,
Dutilly & Lepage 38558 (DAO); Mammammatawa, 50°16'N, 84°47'W, 2 Aug
1960, Lepage 38340 (DAO); North French River, 50°26'30”N, 81°03’W, 20 Jul
1979, Riley 11026 (CAN); Kenora District, Aquatuk Lake, Patricia Portion,
54°21'30"N, 84°36’W, 11 Aug 1980, Riley 11763 (micH); Black Duck River,
19 Jul 1953, Moir 1939 (CAN, MIN); Brant River, 22 May 1973, Maycock
19226 (TRTE); Goose Creek, Hudson Bay, 18—20 Aug 1952, Moir 1556 (MIN);
James Bay, River Opinaga, 54°12’N, 26 Aug 1953, Lepage 31622 (DAO);
Jigsaw Islands, 13 Jul 1958, Baldwin 7631 (CAN); Henrietta-Maria, Hudson
Bay, 54°48’'N, 82°20’W, Jul 1979, Sims 2649b (MICH); James Bay, Winisk
River, 55°05’ N, 85°20'W, 10 Aug 1962, Dutilly & Fernette 40003 (mT); James
Bay, Albany River, 7 Aug 1960, Duman 38578 (my); Thunder Bay District,
Lake Nipigon, Flat Rock Portage, E side of South Bay, 26 Jul 1960, Garton
7797 (MSC, MT, NHA); Thunder Cape, 48°20’N, 88°50’W, 31 Jul 1936, Taylor,
Losee & Bannan 1473 (CAN, GH); Terrace Bay, 48°46’N, 87°07'W, 13 Jul
1966, Parmellee & Savile 3646 (DAO); Mortimer Island, Bernard Point,
48°40'N, 87°04’'W, 30 Jun 1973, Given & Soper 73166 (MICH); QUEBEC: Black
Lake, Caribou Hill, 16 Jul 1951, Raymond et al. 1457, 1626 (DAO, MT);
bou Lake, 20 May 1965, Blais et al. s.n. (CAN, SASK); Coleraine, 3 Aug
1977, Beach 43 (TRTE); Diana Bay, 10 Aug 1936, Ney & Courtright 2404
(CAN); Fort Chimo, 22 Jul 1963, Legault 6770 (DAO, MT, SASK); Great Whale
River, 2 mi. N of Hudson Bay Post, 55°17’N, 77°47'W, 1 Aug 1949, Savile
562 (MT, NA); Marble Mountain, North Canton, 19 May 1970, Hamel, Forest
& Brisson 70048 (DAO); Mont Caribou, 7 Jun 1981, Blondeau s.n. (CAN);
Mont Logan, 20 Jun 1948, Levesque 48400 (DAO); Shickshock Mts., 27 Aug
1882, Macoun 31-836 (CAN); pee Territory, Lake Albanel, Presqu’ile
Sylvie, 51°5'44’N, 73°43’W, 1-7 Aug 1944, Rousseau & Rouleau 1227 (MT);
Gaspé, Bonaventure Co., aaauale River, 2-9 Aug 1904, Collins, Fernald
& Pease 5795, 5934, 5935 (Gu); Gaspé-Est Co., le Bonaventure, 28 Jul 1950,
Fabius & Allyne 3029 (pao); 3 mi. W of Cap-des-Rosiers-Est, 18 Aug 1971,
Morisset 71-581 (CAN); Grand River, 21 Jul 1975, Churchill 722104 (msc),
Mt. Percé, 25 Jul 1905, Williams, Collins & Fernald (GH, MIN); Petit Pabos
River, 2 Jul 1941, Scoggan 1802 ise danosgngie Co., Mont Albert, 21
Jul 1906, Fernald & Collins s.n. (CAN, GH, MSC, MT, VT, US); Saint Ann River,
Pare de la Gaspésie, 31 Jul 1956, a 68192 (mT); LIle d’ Anticosti,
Cirque a la Chaloupe, 7 mi. from ocean, 14 Jul 1 1942, Rousseau 52282, 52283
(mT); Riviere du Brick, 23 Jul 1927, Marie-Victorin & Rolland-Germain 27-

176 Rhodora [Vol. 101

510, 511 (CAN, CAS, F, MO, MT, NY, PH, WS); Riviére Chicotte, 24 Jul 1927,
Marie-Victorin & Rolland-Germain 27-512 (CAS, MT, MO, NY, UC, WIS); Ri-
viére 4 la Patate, 25 Jul 1925, Marie-Victorin et al. 20100 (MT, NY, WIS, US);
Riviére au Saumon, 11 Aug 1927, Marie-Victorin & Rolland-Germain 27-
509 (MO, MT, US); Riviére Pavillon, 17 Jul 1942, Rousseau 52313 (MT); Ri-
viére Vaureal, 27 Jul 1925, Marie-Victorin & Rolland-Germain 20495,
20496, 20497 (MT, US, NY); Matane Co., Mt. Collins, Nettle Gully, 9 Jul 1923,
Fernald et al. 25509 (CAN, CAS, F, GH, MO, MT, NY, UC, US); Mt. Pembroke,
Kowal 78 (wis); Cape Jones, N of portage, 24—25 Jun 1947, Baldwin, Hustich,
Kucyniak & Tuomikosky 333 (CAN, WS); James Bay, Opinaca River, 54°12'N,
26 Aug 1953, Dutilly 31622 (mT); South Twin Island, 53°8'’N, 80°00’W, 15
Jul 1929, Porsild 4213 (CAN); Solomons Temple Island, 14-17 Jul 1949,
Baldwin 1657, 1693 (CAN); Bear Island, 17 Aug 1947, Coates s.n. (CAN); Pte.
au Huard, Pint Hills, 11 Jul 1947, Baldwin et al. 334 (CAN); Port Harrison,
58°17'N, 78°10'W, 18-20 Aug 1928, Malte 120819 (CAN); Richmond Gulf,
14 Aug 1944, Lepage & Dutilly 13103 (GH); Smith Island, east coast of
Hudson Bay, 60°47'N, 78°36’W, 24 Aug 1928, Malte 120899 (CAN, GH, MT);
Ungava District, Knob Lake near Lake Gillard, 16 Aug 1948, Hustich 540
(GH, MT); Payne River, near 60°N, 71°25'W, 11 Aug 1948, Rousseau 1121,
1143 (mT); Portland Island, 55°20'N, 78°50'W, 13 Sep 1939, Dutilly, O’Neill
& Duman 87948 (BH, DAO, GH, MIN, MT, PAC); Porpoise Cove, Hopewell
Sound, 10 Sep 1939, Dutilly, O’Neill & Duman 87799 (usas, US); Port Man-
vers, 56°58'N, 61°23’W, 9 Aug 1939, Dutilly, O’Neill & Duman 7726 (Dao);
Mont Reed, 52°1'N, 68°05’W, 20 Jul 1961, Landry 762 (mr); Ungava Bay,
near Korok Bay, 21 Jul 1951, Rousseau 416 (mt); Windy Tickle, 55°46'N,
60°20'W, Dutilly, O'Neill & Duman 7459 (us); Walrus Point, 13 Jul 1947,
Baldwin et al. 336 (CaN); Wakeham Bay, 61°40'N, 72°5’W, 30 Jul 1928,
Malte 120262 (CAN); SASKATCHEWAN: Churchbridge, E of Yorktown, Grand
Trunk Pacific Railway, 4 Jul 1908, Macoun & Herriot 72763 (cu, us); Dry
Lake, 12 mi. S of Indian Lake, 16 Jun 1964, Ledingham et al. 3736 (DAO);
Hasbala Lake, 59°55'N, 102°05’W, 13 Jul 1963, Argus 173-63 (CAN, DAO, GH,
SASK); Insinger, 5 mi. N, 15 Jun 1952, Boivin & Alex 9313 (DAO, SASK);
Kisbey, 13 Jul 1951, Boivin & Dore 7821 (DAO); Lipton, Clokey 294 (uc,
us); McIntyre Creek, 1 mi. E of Quantock, 7 Aug 1980, Ledingham 6840
(UsAS); Muenster, 11 Jul 1928, Ledingham s.n. (SASK); Mortlach, 12 Jun 1950,
Ledingham 79] (usas); Paterson Lake, 59°55'N, 102°20'W, 27 Jul 1963, Ar-
gus 443-63 (SASK); Patience Lake, 3 Jun 1940, Ledingham s.n. (SASK); Prince
Albert, 19 Jun 1949, Ledingham 49-251 (MT, SASK, USAS); Quillwort Lake, S
of Hasbala Lake, 59°54’N, 102°05’W, 28 Jul 1962, Argus 843-62 (SASK);
Raymore, 12 mi. N of Tower, 4 Jul 1976, Hudson 3166 (DAO, SASK, USAS);
Watson, 19 Jul 1952, Russell 521-87 (DAO); Wiseton, 27 May 1978, Hudson
3513 (DAO, SASK, USAS); E of Yorkton on Grand Trunk Pacific Railway, 4 Jul

906, Macoun & Herriot 72763, 72764 (F); YUKON TERRITORY: Atlin Lake,
60°22’N, 133°51'W, 19 Aug 1943, Raup & Correll 11438 (micu); Blackstone
Valley, along Dempster Hwy. mile 83, 4 Jul 1968, Porsild 1513 (CAN); Boul-
der Creek, 68°27'N, 138°13’W, 22 Jun 1974, Nagy & Goski 74-159 (pao);
Bridge Creek, 61°35'N, 138°50’W, 6 Jul 1948, Raup, Drury & Raup 13345
(AA, CAN, GH); British Mountains, 69°13N’, 139°37'W, 21 Jul 1972, Wein et
al. 264 (Dao); 90 mi. NW of Dawson City, SE of Mt. Klotz, 62°21’N,

1999] Dunlop and Crow—Taxonomy of Carex 177

140°06'W, 6 Jul 1973, Greene 386, 389 (ALTA, DAO); Donjek River, 11 Aug
1927, Miiller s.n. (NY); Firth River, 69°22'N, 139°25'W, 18 Jul 1972, Wein

(DAO); Sieadie National Park, Bidtiod Creek-Sheep Creek Plateau, ca. 7 km
NW of Slims River, 3 Jul 1975, Douglas 8471 (DAO); Lapie Lake, near mile
105, Rose-Lapie R. Pass, 10 Jun 1944, Porsild & Breitung 9290 (Gx);
McQuesten area, 63—64°N and 136—138°W, 12 Aug 1948, Campbell 809
(CAN); mile 123 Haines Highway, (ca. - 5 km W), 11 Jul 1975, Weaver 137,
138 (DAO); 24-mile Cabin on 60-mile Road from West Dawson to Alaskan
border, 64°13'N, 140°06'W, 15 Aug os Calder 4517 (CAS, RM, MT, NA, WS);
60-mile Road, 57 mi. from Dawson to Alaskan border, 64°05’N, 140°53’W,
9-10 Jul 1949, Calder & Billard 3590 (DAO); mile 85 Haines Road, 17 Jul
1944, Clarke 554 (CAN); Mt. Caribou, N of Carcross, 60°14'’N, 134°42’W,
Calder 4528 (mT); Mt. Sedgwick, British Mts. 68°53’N, 139°06’W, 19 Jul
1962, Calder 34460 (DAO); Mt. Schaeffer, 6743" N, 139°48’W, 10 Aug 1971,
Wein et al. 142d (DAO); Mt. White 7 mi. E of Little Atlin Lake, 19 Aug
1943, Raup & Soper 11438 (SASK); Old Crow Flats, 68°15’N, 138°50’W, 11
Jul 1970, Welsh & Rigby (NY); Ogilvie Mts. 65°37'N, 138°56'W, 26 Jul 1960,
Calder & Gillett 26004 (DAO); 52 mi. NE of Dawson, 15 Jul 1963, Youngman
& sige 342, 343 (CAN); Ptarmigan Heart, 61°49’N, 138°35'W, 16 Jul 1948,
aup, Drury & Raup 13701 (AA, CAN, MICH); Red Tail Lake, 61°50'N,
138°52’ ie 9 Jul 1948, Raup, Drury & Raup 13469 (AA, CAN); Ruby Range,
Gladstone Creek, 61°17'N, 138°36'30’W, 12 Jul 1966, Neilson 816 (CAN); St.
Elias Mts., Dezadeash River Valley, 3 Jun 1967, Pearson 67-22 (CAN); Sam
Lake, 13 Jul 1974, Nagy & Pearson 74-304 (DAO); Spruce Creek, 19 Jul
1974, Nagy & Pearson 74-477 (Dao); Yeiken River, Rink Rapids, 9 Jul 1902,
Macoun 53898 ies NY); White River on Alaska Hwy., 21 Jul 1944, An-
derson 9308 (CAN, :
Miquelon. ‘reach Cape Miquelon, 27 Jul 1937, Hors 50 (mt), 22 Jul
1942, Le Gallo 187 (mT); Voiles Blanches, 17 Aug 1939, Hors 50-a (MT
sia Athetniaatl Fjord, 19 Jul 1924, Porsild s.n. (CAN, GH, MO,
us); Amitsuarssuk, 60°08'N, 44°45’W, 7 Aug 1967, Hansen, ee i
Allgaard 67-1920 (pao); Angmagssalik Dist., Gingertivag, 14 Jul 1969, Ha-
mann & Kliim-Nielsen 69-1368 (NY); Battle Harbour, 29 Jun 1883, Waghorne

ale Ella Island, Cape Osw
Sgrensen 3120 (CAN); eben 63°13" N, 50°14’ W. 16 Jul 1972, pda
& Feilberg 4301 (Mo); Gioseland, Faxe S¢, 70°15’N, 29°W, 21 Jul 1958,
Holmen & Laegaard s.n. (DAO); Godhaab Gulf, Jordan Hill, 74°07’N, 27 Jul
1930, Seidenfaden 825 (NY); Hurry Fjord, 70°52'N, 22°30'W, Liverpool Land,

14 Jul 1963, Taggart s.n. (CAN); Igdlorssuit, 17 Jul 1966, Gravesen & Hansen
66-1848 (Mo); Ikasaulaq, 65°59’N, 37°26'W, Astrup & Kliim-Nielsen 25 (MoO);
Ikertog, 66°56'N, 52°20’W, 31 Jul 1978, Moller s.n. (COLO); Ikerasak Umanaq
Distrikt, 70°29’'N, 9 Jul 1929, Porsild s.n. (CAN, MT); Itivdlerssuaq, 60°10'N,

44°29'W, 28 Jul 1967, Hansen, Kliim-Nielsen & Ollgaard 67-535 (CAN); Ju-

178 Rhodora [Vol. 101

lianehaab, near Sgen, 30 Aug 1937, Grontved 2114 (DAO); Kangerdlugsuak,
Knud Rasmussen Land, Skaergaerd Peninsula, 17 Aug 1936, Wager & Wager
s.n. (DAO); Kangerssuneq Quigordleq, Anivia, 60°19'N, 44°07’W, 4 Jul 1966,
Hansen 66-1047 (Mo); Kjerulf Fjord, 8 Aug 1937, Oosting 1014 (cas); Kong
Oscars Fjord, 72°14’N, 23°55’W, 1 Jul 1956, Raup, Raup & Washborn 25
(CAN); Kangmiut, 60°00’N, 44°28’W, 2 Jul 1967, Hansen, Kliim-Nielsen &
Allgarrd 67-924, 969 (NY); Praestefjeld, 66°55'N, 53°35’W, 5 Jul 1949, Gelt-
ing s.n. (COLO); Quinqua, 60°21'N, 23 Jul 1925, Porsild & Porsild s.n. (us);
Scoresbysund, 71°20'N, 24°40'W, 13 Aug 1937, Sorensen 259 (MT); Skeldal,
72°15'N, 24°W, 16 Jul 1963, Spearing et al. 171 (mic); Séudre Strémfjord,
7 Aug 1927, Erlanson 2584 (MICH, NY); Tasissarssik Fjord, 66°05’N, 37°00'W,

14 Jul 1963, Gribbon 28 (CAN); Tasiusak, 61°45'N, 25 Jul 1889, Hartz s.n.

1962, Hansen, Hansen & Petersen 2235 (DAO); Ymer Island, Botanikerbug-
ten, 73°08'N, 25°10’W, 18 Aug 1932, Sérensen 3116 (CAN).

Norway. Norland Province, Junkerdalen, Salten, Mt. Solvagtind, 66°48’N,
15°35’E, 9 Aug 1859, Behm s.n. (uc), 8 Aug 1859, Schlyter & Behm s.n. (F,
Ny) 18 Aug 1883, Nessen 805 (F), 9 Jul 1948, Jordal 1202 (F, MICH

DAO, UBC); Madadam Oblast, Chukotskiy Peninsula, (NE coast) near mouth
of Chegitum River, 12 Aug 1971, Sekretareka, Sitin & Yurtsev (ALA); middle
branch of Erguveem River (left bank) near mouth of Vatamkaivan River,
Pepenveem River, | Aug 1970, Nechaeva (ALA); middle branch of Utaveem

Mountains, middle branch of southern Pekul’nayevem River, 8 Aug 1979,
Korobkov & Sekretareva (Ny); Anyuiskoye Upland, 15 Aug 1973, Petrovsky
(ALA); southern spur of Teniah Mts., at source of the Loran River, 14 Aug
1972, Gorbukova, Makarova & Plieva (ALA); SW coast of Chukotskiy Pen-
insula, near Nunligran settlement, 28 Aug 1970, Afonina, Korobkov, Plieva
& Khrenov (ALA); Anyuiskoye Upland, Pogingen River, 8 Aug 1976, Pe-
trovsky & Korobkov (ALA).

United States. ALaska: Alaktak, Half Moon, 70°45'N, 155°00’W, 1 Aug
1949, Spetzman 2439 (CAN, US); Anaktuvuk Pass, 12-15 Aug 1960, Hultén

DAO); Bonanza Creek, Eagle Summit, 16 Jul 1949, Scamman 5270 (GH);
Brooks Range, airstrip at ‘Nolan’, 19 Jun 1949, Jordal 1839 (BH, MICH); 46

i of Arctic Village, 68°40'N, 146°30’W, 18 Aug 1973, Hettinger
814 (CAN); Cane Creek, 68°35'N, 144°50’W, 8 Aug 1972, Hettinger 159

1999] Dunlop and Crow—Taxonomy of Carex 179

(ALTA); Cape Beaufort, 3-7 Aug 1961, Hultén s.n. (DAO, GH); Chip River,
70°26'N, 154°50'W, 17 Jul 1956, Wiggins 13674 (ps, us); Chitina River
head, 16 Jun 1925, Laing 20 (CAN); Chugach Mts., Anchorage, 29 Jun 1948,
LePage 23355 (us); Circle Hot Springs, 138 mi. N of Fairbanks, 17—22 Jul
1936, Scamman 69 (Gu); Colville River, 150°45'W, 69°45'N, 10 Aug 1953,
Cantlon et al. 649 (msc); Delta River, S of Donnely Inn, 10 Aug 1966,
Foote 8075 (RM); Daipaious Creek, 21 Jul 1958, Packer s.n. (ALTA); Don-
nely Dome, mile 250 Richardson Hwy., 63°47'N, 145°45'W, 2 Aug 1951,
Cody 6284, 6286 (DAO); Farwell Lake, 62°33'N, 153°36'W, 3-4 Aug 1949,
Drury 2463 (GH); Fairbanks, Miller House on Steese Hwy., 12—28 Jul 1940,
Scamman 2009 (GH); Firth River, 2 mi. S of junction Firth & Mancha Creek,
11 Aug 1961, Stone (RM); Fish Creek, 70°19'N, 151°58'W, 26 Jul 1977,
Murray & Johnson 6532 (CAN); Index Mountain 40 mi. ENE of Arctic
Village, 68°15’N, 144°10’'W, 11 Jul 1973, Hettinger 235, 246 (CAN, ALTA);
Jago Lake, 69°26’N, 143°47'W, 23 Jul 1957, Cantlon & Gillis 57-1295
(msc); King Lodge, Border, Dawson Road, (E of Chicken), 12 Jul 1963,
Spetzman 4883 (CAN); Kodiak, 28 Jul 1904, Piper 4776 (us); Kogosuknuk
River, 69°45'N, 151°45’W, 16 Jul 1953, Borman, Rebuck & Cantlon 35]
(MSC); 69°46’N, 151°40’W, 16 Jul 1953, Borman, Rebuck & Cantlon 398,
403 (MSC); Kongekat River Hill, 138 mi. NNE of Arctic Village, 69°34'N,
141°50'W, 19 Jul 1973, Hettinger 347 (CAN, ALTA); Kaness River, 15 mi.
SSE of Arctic Village, 67°46’N, 143°45'W, 3 Jul 1973, Hettinger & Boyce
175 & 176 (ALTA); Kotzebue Sound, 9-16 Aug 1945, Scamman 3967 (GH);
Kotzebue, 12 Aug 1938, Anderson 4679 (cas); Big River, 61°55’N,
154°25’W, 10 Jul 1950, Drury 4211 (GH); Kuskokwim River, Swift River,
62°40'N, 152°30'W, 19 Jul 1961, Viereck 5067 (CAN); Kenai Peninsula,
Steton Creek Valley, 3 Aug 1951, Calder 6444 (cas, DAO); Moose Pass,
60°32'N, 149°32'W, 31 Jul 1951, Calder 6388 (DAO); Knife Ridge, 2 mi. N
of Knifeblade, 2 Aug 1951, Jones 717 (ws); Kokrines Mts., 65°17’N,
154°30'W, 6 Jul 1926, Porsild 659-60 (CAN, MT, US); Lake Noluk, 2 se
1950, Thompson 1337 (ps, us); Lake Schrader, 69°25’N, 145°00'W, 8 Jul
1948, Spetzman 529 (Ds, us); Lazy Mt., E of Palmer, 29 Jul 1965, Mitchell
729b6 (DAO); Livengood, 9 Jul 1944, Anderson 9019 (CAN, MSC); Lodiack,
21 Jul 1904, Piper 4776 (pom); Mt. McKinley National Park, 2 mi. N of N
entrance, 29 Jul 1967, Hermann 21517 (micH, NY); Mt. Eielson, Coppers
Mt., 11 Jul 1956, Viereck 1250A (MIN, RSA); Hines Creek, 6 Aug 1950,
Bailey 5017 (uc); Savage River, 31 Jul 1932, Henderson 14790 (ORE); Tok-
lat Cabin, 11 Jul 1939, Murie 35 (RM); Polychrome Pass, mile 43, 1-10 Jul
1964, Hultén s.n. (AA); 63°43'N, 149°15'W, 13-22 Jun 1937, Scamman 585
(GH); Meade River, ca. 15 km from Atkasuk, 70°28'N, 157°25'W, 30 Jun
1966, DeBenedictis 92, 534 (MICH); milepost 50, along Pipeline Haul Road,
6 Aug 1981, Allred, Welsh & White 1214 (rsa); Mt. Dustin, 21 mi. from
Nome, 4 Jul 1938, Anderson 3768 (cas); Nabesna River, 7 Aug 1902,
Schrader & Hartman 67 (us); Nelchina Caribou Range, Tyrone Creek,

(us); Nome Quad, meadow below radio tower, Anvil Mt., 64°31'N,
165°30’W, 11 Jul 1982, Kelso 82-39 (COLO); Nome, 1900, Blaisdell 139
(uc); Ogotoruk Creek, Cape Thompson, 27 Jul 1966, DeBenedictis 421
(MICH); Okpilak Valley, 69°25'N, 144°02'W, 30 Jun 1958, Cantlon & Mal-

180 Rhodora [Vol. 101

com 58-0117 (msc); Old John Lake, 27 Jul 1950, Jordal 375] (BH, MICH,
MT); Pastolik, 5 Jul 1928, Miller 88c (Us); Port San Juan, Evans Island, 10
Aug 1948, Eyerdam 7031 (MIN, OSC, RM, WS); Prince of Wales Island, Vir-
ginia Mt., 7 mi. S of Pt. Baker, 19 Jul 1972, Jaques 1476 (osu); Rapids
Lodge, 138 mi. S of Fairbanks on Richardson Hwy., 25-28 Aug 1937,
Scamman 1046 (Gu); Seward Peninsula, 64°33'N, 163°45’W, 5-6 Aug 1926,
Porsild & Porsild 1193-94 (CAN, GH); Sheenjek River, 68°22’N, 143°55’W,
19 Jun 1956, Schaller 54 (mT); Sheenjek River, 68°36’N, 143°45’'W, 11 Jun
1956, Schaller 163 (mT); Snow Camp, Sagavanirkton River, 1958, Korando
& Shanks s.n. (NY); Sunset Pass, 69°40’N, 144°45'W, 13 Aug 1948, Spetz-

5433 (GH); Umiat Mt., 2 Jul 1953, Borman 3394 (mT); 40 mi. NW of Umiat,
29 Jul 1951, Jones 723 (ws); Umiat, 69°25'N, 152°10'W, 25 Jun 1953,
Bormann, Rebuck & Cantlon 118 (msc); Upper Marshfork River, 46 mi.
NNW of Arctic Village, 68°40'N, 146°30’W, 18 Aug 1973, Hettinger 814
(ALTA); White River Valley, 61°42’N, 141°39’W, 17 Aug 1968, Murray 2279
(CAN); Alaska-Yukon Boundary, Firth River and Mancha Creek, 11 Aug

Hilltop Mine, 12 Jul 1967, Weber 13299 (coLo); Fairplay, Horseshoe
Cirque, T10 R79W S12, 21 Jul 1985, Dunlop & Orlando 2025 (NHA); South
Park, 1873, Wolfe 1002 (COLO, F, MICH, NY, US); IDAHO: County unknown,
Soda Springs, 25 May 1934, Davis 83-34 (Ny); Upper Priest River, 20 Jul
1925, Epling 7513 (uc); MAINE: Aroostook Co., Aroostook River Basin, 15
Jun 1940, Chamberlain 1579 (MAINE, uc); Aroostook River, Fort Fairfield,
5 Jun 1901, Fernald s.n. (GH, MAINE); Piscataquis Co., Mt. Katahdin, 4 Jul
1856, Blake s.n. (MAINE, NHA); North Basin headwall below Hamlin Peak,
1 Aug 1929, Ewer 226 (mass); W end of North Basin, 26 Jul 1929, Ewer

t:
2749 (US); MICHIGAN: Delta Co., Escanaba River ca. 1 mi. NE of Cornell,
ca. 10 mi. NW of Gladstone, 23 Aug 1982, Voss 15553 (MICH); MINNESOTA:

Gunsight Pass, 25 Aug 1919, Standley 18139 (ny, US); Pigeon Pass, 22 Jul
1958, Bamberg 92 (coLo); Reynolds Mt., 2 Aug 1960, Schofield s.n. (MON-

1999] Dunlop and Crow—Taxonomy of Carex 181

TU); St. Mary Lake, 6 Aug 1919, Standley 17150 (us); MacDonald Lake, 3
Aug 1895, Williams s.n. (NY, US); Altyn Peak, 13 Jul 1919, Standley 15596
(NY, Us); Divide Mountain, 9 Aug 1964, Harvey & Pemble 7175 (MONTU,
WTU); Teton Co., Pine Butte Preserve, 23 Jun 1982, Lesica 2055 (MONTU);
Antelope Butte, 22 Jul 1982, Lackschewitz & Ramsden 10049 (COLO, MON-
TU); Duhr Fen, 16 Aug 1982, Lesica 2408 (MONTU, WTU); Mt. Patrick Pass,
30 Jul 1983, Lackschewitz 10609 (MONTU, NY); NEVADA: Elko Co. , Ruby
Valley, Point Hot Springs, T27N RS8E S15, 20 Jun 1984, Tiehm, Atwood
& Williams 8748 (NY, ORE); Ruby Mts., Seitz Lake, T32N RS58E $20, 16
Sep 1983, Goodrich, Smith & Tuhy 20183 (BRY); Ruby Mts., T29N R57E,
NW of Harrison Pass, 15 Aug 1980, Atwood 7713 (sry); Lamoille Canyon,
Thomas Canyon Camp, 15 Jun 1941, Holmgren 1130 (Ny, uc); W of Ruby
Mts., along Rt. 229, T32N R60E S19, 4 Aug 1985, Dunlop & Orlando
2140 (NHA); White Pine Co., Monte Neva Hot Spring, 17 mi. N of McGill,
4 Aug 1985, Dunlop & Orlando 2130 (NHA); NEW HAMPSHIRE: Carroll Co.,
Albany, Mt. Chocorua, 4 Jul 1978, Storks 385 (NHA); Hart’s Location, Mt.
Willard, Butterwort Flume, 23 Sep 1984, Dunlop & Orlando 1965-1968
(NHA); Coos Co., Mt. Washington, mete Geers 31 Jul 1977, Storks 147
(NHA); Grafton C4. Franconia, Cannon Mt., 4 Aug 1960, Hodgdon 11670
(NHA); alpine areas of Franconia ty. Oakes Bee (MASS); Mt. Lincoln,
summit, 18 Jul 1915, Fernald & Smiley 11607 (cu, GH, NY, US); Mt. Lafay-
ette, 23 Aug 1865, Blake (GH, NHA); Grafton Co., Lyme, on Winslow Ledge,
25 Jun 1984, Dunlop, Korpi & Hency 2394 (NHA); NEW YORK: Essex Co
N end Indian Pass, 5 Aug 1948, Smith 4602 (NA); Wilmington, Whiteface
Mt., 7 Jul 1986, Dunlop & Orlando 2414 (NHA); Avalanche Pass, Mt. Mar-

: Dunn Co.

Mts., east slope, 11 Aug 1951, Stevens 1293 (CAN, UC, US); Rolette Co.,
ie Rolette & Thorne, 3 Jun 1913, Lunell 767236 (MIN, US); OREGON:
Wallowa Co., E side Lostine Canyon, 18 mi. above Lostine, 22 Jul 1933,
Peck 17861 (DS, NY, WILLU); Hurricane Creek, 23 Jul 1944, Peck 22549 (uc

WILLU); Ice Lake ecm T4S R44E S12, 11 Aug 1961, Mason 1902
(OSC); UTAH: Duchesne Co., Ashley National Forest, Four Lakes Basin, 22
Aug 1974, Gasieeh "3736 (BRY); Emery Co., Scad Valley, T15S R6E S27,
5 Aug 1984, Lewis & Lewis 7758 (BRY, UT); Garfield Co., Dixie National
Forest, Pine Lake Campground, 31 Jul 1985, Dunlop & Orlando 2100
(NHA); Upper Henderson Canyon, T35S RIW S32, ca. 11 NE of Tropic, 4
Jul 1983, Tuhy 863 (RSA); Iron Co., Cedar Breaks, T36S ROW S24, ca. 13
mi. S of Parowan, near Brian Head, 20 Jul 1977, Welsh & Clark 15512
(BRY, NY); VERMONT: fhnaaite tbat Co., Mt. Equinox, Deer Knoll, 5 May
1985, D Dunlop, Brackley & Thompson 2003 (NHA); Lamoille Co., Smugglers

Ca '
1956, yates 2288 (vT); Orleans Co., Willoughby Cliffs, 19 Jul 1885,
Deane s.n. (BH, GH, NY), 25 Jun 1949, Hodgdon 6046 (NHA);, Mt. Pisgah,
Lake Willoughby, along Rt. 5A, 16 Aug aan Ahles 78931 (MASS); WYOM-
ING: Johnson Co., Big Horn Mts., 33 mi. NW of Buffalo, TS53N R87W S27,
7 Aug 1979, Nelson 4705 (RM); Park Co., Clay Butte, 15 Aug 1979, Dorn
3377 (RM); Sheridan Co., Big Horn Mt., TS7N R9OW S19, 5 Aug 1979,

182 Rhodora [Vol. 101

Nelson 4681 (RM); Tongue River, Aug 1953, Beetle 6297 (RM); Uinta Co.,
5 mi. SW of Hilliard, 25 Jun 1950, Beetle 11062 (RM).

1b. Carex scirpoidea Michx. ssp. pseudoscirpoidea (Rydberg)
Dunlop, Novon 7: 355. 1997. Carex pseudoscirpoidea Ryd-
berg, Mem. N.Y. Bot. Gard. 1: 78. 1900. Carex scirpoidea
var. pseudoscirpoidea (Rydberg) Cronquist, Univ. Wash.
Publ. Biol. 17(1): 325. 1969. Type: u.s.A. Montana: Spanish
Basin, Jul 1896, Rydberg 3064 (LECTOTYPE: NY! designated
by Mackenzie).

Rhizomes elongate, with regularly spaced shoots, internodes
1—2 cm long. Culms usually 1—few per node, arising from shoots
of the previous year and retaining the withered, persistent leaf
bases of the previous year, scabrous towards apex. Pistillate culms
0.5-1.5 mm wide at top, 0.8-2 mm wide at the base, 5—31 cm
tall. Staminate culms 0.9-1.3 mm wide at top, 1.2-2 mm wide
at the base, 9-27 cm tall. Leaf sheaths of the rhizome and culm
base red-brown to brown-black, glabrous, shiny, becoming fi-
brous with age. Leaves of the flowering shoots 3—5, clustered,
blades diverging from one region up to 20 mm above the culm
base, adaxial surface glabrous, scabrous along the Margins; in
pistillate plants 7-19 cm long, 1.2-3.5 mm wide; in staminate
plants 9-12 cm long, 1.5—2.8 mm wide. Vegetative leaves 5-8
per shoot; in pistillate plants 7-21 cm long, 1.6-3 mm wide; in
staminate plants 9-13 cm long, 1.5—2.5 mm wide; ligules semi-
circular, 1—-1.4 mm in height, 1.7-3 mm wide. Inflorescences uni-
sexual, unispicate (very rarely with a short sessile lateral spike),
erect, linear to oblong, densely flowered: pistillate spikes 10—34
mm long, 3.5—5 mm wide; staminate spikes 10-20 mm long, 3.5—
4 mm wide. Involucral bracts often absent, when present folia-
ceous, shorter than the inflorescence, 6-40 mm long, occasionally
scale-like (less than 1 mm and similar to inflorescence scales),
inserted on culms 10—47 mm below spike, base occasionally au-
riculate. Pistillate scales ovate, 2—2.6 (3) mm long, 1.1-1.5 mm
wide, longer and wider than the perigynia, apically obtuse, red-

1-1.6 mm wide, abruptly contracted to a beak, lacking a stipe,
nerveless, white to light green, becoming red-brown to dark

1999] Dunlop and Crow—Taxonomy of Carex 183

brown towards the apex, hirsute with white to tan hairs; body
tightly enveloping the achene; beak 0.1—0.3 mm long, red-brown,
straight at maturity, orifice entire and oval. Achenes light brown,
1.5—-1.8 mm long, 0.9-1.2 mm wide, lacking a stipe, filling the
perigynia or at least % the length and width. Rachilla absent.
Anthers 3 mm long.

DISTRIBUTION. Carex scirpoidea ssp. pseudoscirpoidea is widely
distributed in the higher elevations of the western mountains (Fig-
ure 2). It is found chiefly in the San Juan Mountains in Colorado;
Uinta and La Salle Mountains in Utah; the Sierra Nevada Range
in California; Steen Mountains in Oregon; the Sawtooth Range
in Idaho; the Little Belts Range, Anaconda-Pintlar Range and
Beartooth Plateau in Montana; and the Okanagan Range in east-
ern Washington and southern British Columbia

HABITAT. Subspecies pseudoscirpoidea occurs at elevations from
3300 to 3900 m, on dry ridge sites and alpine fellfields with
gravelly and non-calcareous soils.

Subspecies pseudoscirpoidea is distinct ecologically, occurring
chiefly in high elevation sites in mountain ranges in the West.
This taxon is distinguished by culms that arise from second year
shoots, clothed at the base by the withered and persistent leaf
bases of the previous year. Generally, a single culm arises from
a node and internodes of the rhizome are elongated, typically 1—
2 cm. The leaves are clustered, diverging from the shoot axis at
One point approximately 10-20 mm above the rhizome, in con-
trast to other taxa in which the leaves diverge from the stem at
scattered intervals along the shoot axis. The plants generally have
shorter and wider leaves than those of ssp. scirpoidea.

In lectotypifying Carex pseudoscirpoidea, Mackenzie (1935)
chose Rydberg 3064 (NY) as the lectotype. Unfortunately, this is
a staminate plant and does not possess some of the diagnostic
features of the taxon.

REPRESENTATIVE SPECIMENS: Canada. BRITISH COLUMBIA: Cathedral Ridge,
ca. 4% mi. N of Monument 95, 28 Aug 1972, Douglas & Douglas 4629
(ALA); Cathedral Park, Lake Lady Slipper, 12 Jul 1975, Hainault 7728 (Dao),
14 Jul 1975, Hainault 7526 (DAO); Lakeview ridge, 28 Jul 1976, Hainault
7962 (DAO); Mt. Apex, 11 Aug 1964, McLean & Haupt 65-64 (DAO), McLean
& Marchand 65-63 (DAO); Mt. Bomford, Cathedral Lakes, Ashnolda District,
49°N, 120°15'W, 11 Jul 1951, Taylor 1359 (uBc).

184 Bhidora [Vol. 101

United States. caLiForNiA: Alpine Co., Carson Pass, Round Top Lake to
Fourth of July Lake, 29 Aug 1974, Taylor 4910 (DAV); Mono Co., Minarets
Wilderness Area, Inyo National Forest, Dana Plateau, N of Mt. Dana, TIN
R25E S28, 7 Aug 1985, Dunlop & Orlando 2158 (NHA); COLORADO: Chaffee
Co., Monarch Pass, 20 mi. W of Salida, 22 Jun 1926, Erlanson 2020 (mIcH);
Manassas Creek, 24 Jul 1919, Clokey 3337 (BH, Mo, Ny, RM, UC, US); Gun-

1999] Dunlop and Crow—Taxonomy of Carex 185

nison Co., North Pole Basin, 14 Jul 1955, Weber & Barclay 9193 (COLO, cs,
DS, MT, NY, RM, RSA, UC); La Plata Co., San Juan N a Forest, Chicago
Basin, ‘Ealona. 29 Jul 1962, Michener 724 (cOLo); Sea an Co., San Juan

National Forest, Eldorado Lake, T40N ROW, 19 Jul 1971, instare s.n. (COLO);

Lake, 15 Aug 1979, ele aaiay 9154 (MONTU); Beartooth Mountains near

g state line, 25 mi. S ed Lodge, T9S R19E S32, 22 Jul 1955,
Cronquist 7998 (CAN, CAS, CU, D DS, GH, MICH, MONTU, MT, NY, OSC, RM,
A, UC, WTU); Hell Roaring Plateau, 25 Jul 1921, Simms & Zeh 640 (RM);

R13W S30 & 31, 24 Aug 1985, Dunlop & Orlando 2280 (NHA); Anaconda
Pintlar Wilderness, T3N R14W S36, SW of Mt. Tiny on Storm Lake trail to
Goat Flats, 24 Aug 1985, Dunlop & Orlando 2285 (NHA); Madison Co.,

schewitz & Fageraas 1081 a&b (MONTU); OREGON: Harney Co., Steen Mts.,
bove Alberson, 5 Jul 1925, Peck 14272 (CAS, F, PH, WILLU); Big Indian
Gorge, T33S R33E S35, 28 Aug 1980, Wright 1468 (osc); UTAH: Daggett
ah Leidy Peak, 31 Jul 1929, Dremolski D-7 (RM); Duchesne Co., Atwood

Bluebell Lake, T4N RSW S31 & 32, 30 Jul 1980, Neese & Welsh 214016
(Ny); Uinta Mts. N slope 1 mi. SE of Island Lake, 25 Sep 1983, Neely &

1980, Welsh & Neese 213930 (Ny); San Juan Co., La Sal Mountains, W end
Dark Canyon, Mt. Peale, T27S R24E $13, 26 Jul 1985, Dunlop, Orlando

ph sop i 2075 (NHA); Mt. Mellenthin, T27S R24E S12, 26 Jul 1984, Tuhy
1746 (Bry); Summit Co., Bald Mt. summit, 3 Sep 1953, Lewis 267 (BRY,
CAS); near divide W of Fish Lake on N slopes of Uinta Mts., T2N R1IE S2,
3 Sep 1945, Harrison & Harrison 10971 (BRY, US); rocky washes ing
Dollar Lake, Henry’s Forks Basin, 12 Aug 1936, Maguire, Hobson & Ma-
streamlet bam

Ashley National Forest, 22 mi
Marsh Peak, 19 Aug 1982, Goodrich 1 Ati (BRY, UT); 2 mi. NW of Paradise
Park Res., T3N R1IW S2, 5 Jul 1980, Goodrich 14253 (BRY); E side Leidy
Peak, TIN R19E S31, 24 Jul 1986, Goodrich 22074 (BRY); East Fox Lake,
Uinta River, 14 Aug 1953, Lewis 230 (BRY); WASHINGTON: Okanogan Co.,

186 Rhodora [Vol. 101

Chopaka Mt. ca. 11.5 mi. NW of Loomis, 16 Jul 1972, Douglas & Douglas
3858 (DAO); Tiffany Lake Pass, 24 Jul 1931, Fiker 406 (wILLU, ws); Windy
Peak, ca. 17 mi. NW of Loomis, 17 Aug 1971, Douglas 3120 (RM); WYOMING:
Fremont Co., Shoshone National Forest, East Fork Wind River, 8 Aug 1962,
Johnson 249, 250 (cs, RM); Wind River Range, Roaring Fork Mt., 2 mi. NW
of Silas Lake, 20-26 Jul 1965, Scott 535 (CAN, GH, UC); Johnson Co., Big
Horn Forest, Grasshopper Ridge, Elk Lake, 28 Aug 1961, Johnson 144 (RM);
Park Co., Island Lake, 19 Jul 1948, Daubenmire 48330 (ws); Little Bear

Beetle 16673 (RM); White Rock Mt., near Green River Lakes, 8 Aug 1925,

Payson & Payson 4605 (MO, MSC, NY, PH, RM, WS).

1c. Carex scirpoidea ssp. convoluta (Kiikenthal) Dunlop, Novon
7: 355. 1997. C. scirpoidea var. convoluta Kiikenthal, in En-
gler, Das Pflanzenreich 38 (IV:20): 81. 1909. Type: U.S.A.
Michigan: Thunder Bay Island, 18 Aug 1895, Wheeler s.n.
(HOLOTYPE: B destroyed; ISOTYPES: BH! CAN! GH! MICH! MIN!
MSC! NY! POM! vT!).

Rhizomes short. Culms one to several per node, arising from
current year shoots (lacking any withered persistent leaf bases of
the previous year), scabrous especially at the apex. Pistillate
culms 0.4—0.7 mm wide at the top, 0.8-2.2 mm wide at the base,
(9.2) 19.5—35 (38) cm tall. Staminate culms 0.5—0.9 mm at the
top, 0.9—-1 mm wide at the base, 9-31 cm tall. Leaf sheaths of
the rhizome and the culm base red-brown to brown-black, gla-
brous, shiny, coriaceous with acute hard tips. Leaves of the flow-
ering shoots 2—4, not clustered, adaxial surface glabrous, margins
scabrous; in pistillate plants 7-18 cm long, (0.8) 1.1-1.5 (2) mm
wide; in staminate plants 6-15 cm long, 1—-1.5 wide. Vegetative
leaves 4—9 per shoot; in pistillate plants 10.5—23.4 cm long, (0.7)
1-2 mm wide; in staminate plants 11-16 cm long, 1-1.7 mm
wide; ligules semicircular, 0.2—2 (3) mm in height, 1-2 mm wide.
Inflorescences unisexual, unispicate (very rarely with a short lat-
eral, sessile or subsessile spike), erect, linear, densely flowered;
pistillate spikes slender, (10.6) 15-21 (30) mm long, 2.5-3.5 (4)

wide; staminate spikes 13-30 mm long, 2-3.5 mm wide.
Involucral bract usually absent, when present foliaceous, shorter

an the inflorescence, S21 mm long, base inserted on culm S-
12 mm below spike, auriculate. Pistillate scales ovate to obovate,
(1.5) 2—2.4 mm long, (0.9) 1-1.2 mm wide, equal to or shorter
than perigynia, apex obtuse to acute, red-brown to dark brown
with narrow to broad hyaline margins, central midrib narrow

1999] Dunlop and Crow—Taxonomy of Carex 187

green-tawny to dark brown, extending to scale apex; margins en-
tire. Staminate scales similar to pistillate, 2.5-3.2 mm long, 0.7—
0.9 mm wide. Perigynia ovate to obovate, 1.5—2.6 mm long, (0.7)
1—1.2 mm wide, as wide as the subtending scale, abruptly con-
tracted to a beak, lacking a stipe, nerves absent, basally light
green, becoming tawny to red-brown towards apex, hirsute with
white to tan hairs, body tightly enveloping the achene; beak 0.1
mm long, red-brown and hyaline at tip, straight at maturity, orifice
entire and circular. Achenes dark brown, 1—1.5 mm long, 0.6—0.9
mm wide, sessile or with 0.25 mm stipe, filling the perigynia or
at least %4 the length and width. Rachilla absent. Anthers 1.5—2
mm long.

DISTRIBUTION. This is the most sie apr sais of the
four subspecies (Figure 3), occurring only e shores of
Lake Huron on the Bruce Peninsula, on aoe of - Manitoulin
District, Ontario, and on Drummond Island and Thunder Bay Is-
land, Michigan.

HABITAT. Subspecies convoluta is associated with alvar com-
munities, characterized by Catling and Brownell (1995) and Ste-
phenson (1983), as areas with sparse vegetation and thin soil over
flat limestone or marble substrate. These open alvar communities
contain a number of plant species that are calcicolous, often
drought resistant, and grow in cracks of outcropped limestone
“‘pavements.”

Subspecies convoluta is distinguished by narrow, convolute
leaves of the vegetative and flowering shoots, a strongly cespitose
habit, and a higher number of flowering culms per plant than
other subspecies.

These narrow-leaves plants were first described as a variety of
Carex scirpoidea by Kiikenthal based on specimens collected by
Wheeler in 1895 from Thunder Bay Island, Michigan. Unfortu-
nately, Kiikenthal’s Carex herbarium, presumably including the
holotype of C. scirpoidea vat. convoluta, was sent to Berlin (B)
and was destroyed during World War II (Stafleu and Cowan
1979). Isotypes of Wheeler’s 1895, Thunder Bay Island, Michi-
gan, collections are available.

PRESENTATIVE SPECIMENS: Canada. ONTARIO: Algoma District, Great
Cloche Island, 26 Jul 1956, Soper & Fleischmann 6633 (CAN); Bruce Co.,

188 Rhodora [Vol. 101

Figure 3. Distribution of Carex scirpoidea ssp. convoluta.

DAO, MO, MT); Howdenvale, 31 Jul 1936, Watson 2904 (CU, NY, US); Lion’s
Head, 11 Jun 1932, Marie-Victorin, Rousseau & Prat 45-922 (DAO, GH, MT);
Little Pine Tree Harbour, Zinker Island Cove, 30 Jun 1982, Webber 4552
(TRTE); Oliphant, 9 Aug 1971, Montgomery 3693 (WAT); Red Bay, 9 Jul 1941,
Sargent 5 (GH); Sauble Beach, 20 Jun 1934, Taylor & Fernald s.n. (wis);
Stokes Bay, 26 May 1934, Krotkov 8759 (ny, US), 8792 (GH); Barrie Island,
May 1979, Hogg s.n. (CAN, WAT); Georgian Bay Island National Park, Cove

1999] Dunlop and Crow—Taxonomy of Carex 189

Island, Bass Bay, 22 Sep 1981, Bobbette 7403 (wat); Zinkan Island, 45°04'N,
81°29’W, 15 Jul 1975, Cuddy & Emalie 1815 (CAN); Manitoulin District,
Barrie Island, Rozels Bay, 29 Jul 1985, Hellquist 15513 (Nasc); Green Island
Harbour, 20 Jul 1976, Ringius & Wilson 327 (wat); Hensly Bay, 26 May
1978, Morton & Venn 11521 (wat); La Cloche Peninsula, 20 Aug 1932,
Fassett 14899 (wis, GH), 11 Jul 1957, Pease & Bean 26203 (GH); Whitefish
River W side Hwy. 68, 3 Jul 1976, Catling & McIntosh s.n. (DAO, wis);
Misery Bay, 28 Jul 1972, MacDonald & White 3593 (CAN); Murphy Point,
14 Jul 1952, Senn 5974 (DAO, MT, NY, PAC, US, WS); Tamarack Cove, 20 Jul
1932, Koelz 4206 (MICH, wi: Tamarack Point, Grassl 4594 (MICH).
United States. MICHIGAN: Alpena Co., Thunder Bay Island, 18 Aug 1895,
Wheeler s.n. (BH, CAN, GH, MICH, MIN, MSC, NY, POM, VT); Chippewa Co.,
Drummond Island, Meade Island, 19 Jun 1979, Voss 15074 (MICH).

ld. Carex scirpoidea Michx. ssp. stenochlaena (Holm) Live
and Léve, Taxon 13: 202. 1964. C. scirpoidea Michx. var.
stenochlaena Holm, Amer. J. Sci. TV 18: 20. 1904. C. sten-
ochlaena (Holm) Mackenzie, Bull. Torrey Bot. Club 35: 269.
1908. TYPE: CANADA. British Columbia: Chilliwack Lake, by
a rivulet, 4000 ft., 12 Jul 1901, Macoun 33728 (LECTOTYPE:
CAN 21326! designated herein; ISOLECTOTYPES: CAN! MO! Msc!

NY! us!).

Rhizomes short. Culms several per node, arising from shoots
of the current year, (lacking any withered persistent leaf bases of
the previous year), scabrous toward the apex. Pistillate culms 0.6—
1 mm wide at the top, 1.4-2.1 mm wide at base, 24—34 cm tall.
Staminate culms 0.5—0.8 mm wide at the top, 2.2-3 mm wide at
the base, 14—26 cm tall. Leaf sheaths of the rhizome and the culm
base red-brown to brown-black, glabrous, shiny, coriaceous.
Leaves of the flowering shoot 3—5, not clustered, adaxial surface
glabrous, margins scabrous; in pistillate plants 12.5—25 cm long,
1.42.1 mm wide; in staminate plants 14—20 cm long, 1.5-2.4
mm wide. Vegetative leaves 5—6 per shoot; in pistillate plants
10-28 cm long, 1—2.5 mm wide, in staminate plants 19-24 cm
long, 1.4-2.5 mm wide; ligules semicircular, 0.8— 1.5 mm in
height, 1-2.5 mm wide. Inflorescences unisexual, unispicate (oc-
casionally with a single, short lateral spike), drooping on lax
culms, mostly clavate, loosely-flowered especially at base; pistil-
late spikes 25-30 mm long, 3.5—6.5 mm wide; staminate spikes
(few seen) 18-25 mm long, 4—5 mm wide. Involucral bract sin-
gle, foliaceous, shorter than the inflorescence, 4-40 mm long,
base inserted on culms 10—33 mm below spike, auriculate. Pis-
tillate scales oblong-lanceolate, 2.4—3.5 mm long, 1—-1.5 mm

190 Rhodora [Vol. 101

wide, equal to or shorter than perigynia, apex subacute to acute,
red-brown to black, without hyaline margins; central midrib ob-
scure, only slightly raised, red-brown, but lighter in color than
rest of scale, extending to the apex; margins ciliate. Staminate
scales similar to pistillate, (3.5) 4.5-5 (6) mm long, (0.7) 1—1.4
mm wide. Perigynia lanceolate to oblanceolate, (2.8) 3—4 (5) mm
long, 0.9—1.4 (1.6) mm wide, as wide as subtending scale, taper-
ing gradually to beak, with short basal stipe, adaxial surface
nerveless or with few short obscure basal nerves, red-brown to
black, rarely tan, hirsute with tan to brown hairs, loosely envel-
oping the achene in upper %; beak 0.3-0.5 mm long, dark brown
and not hyaline, reflexed at maturity, orifice entire and abaxially
oblique. Achenes light brown, 1.2-2 mm long, 0.8—1 mm wide,
with 0.25—0.50 mm stipe, filling % to % the length of the peri-
gynia. Rachilla absent. Anthers 3—3.5 mm long.

DISTRIBUTION. This subspecies occurs in the Cascade Mountains
in Washington, the Bitterroot Mountains in Montana, the coastal
ranges in southern British Columbia, and at a few localities in
Alaska and the Yukon (Figure 4).

HABITAT. In the Bitterroot Mountains of Ravalli County, Mon-
tana, this subspecies grows on bedrock terraces between 1615—
2620 m elevation, especially between 2130-2440 m. In Wash-
ington it grows mostly between 1460-2010 m.

This taxon is associated with weakly acidic soils which have
high levels of magnesium and low levels of calcium. Edaphic
requirements may be an important isolating factor for this sub-
species. More detailed studies of habitat requirements and micro-
environments are required before one can speculate on the history
of this taxon and how it is related to the other subspecies.

Subspecies stenochlaena is distinguished by lanceolate peri-
gynia which are greater than 3 mm long, taper gradually to a
beak, and are over 2.5 times as long as wide. The pistillate spikes
are clavate, loosely flowered at the base, and borne on slender,
lax culms which cause the spikes to droop. The pistillate scales
are over 3 mm long, subtending hirsute perigynia with tan, yel-
low, or golden-brown hairs. Both perigynia and pistillate scales
are dark brown to black. Beaks are dark and reflexed at maturity,
with an oblique mouth.

Figure 4. Distribution of Carex scirpoidea ssp. stenochlaena.

A lectotype, designated herein, has been selected from Ma-
coun’s specimens since no specimen was chosen by Holm. The
lectotype (CAN 21326) is a Macoun specimen bearing a “Geologic
Survey of Canada” label, while others bear “Ex. Herb. Geologic

192 Rhodora [Vol. 101

Survey of Canada” labels. The latter are isolectotypes bearin
the same number as the lectotype, but having a slightly different
wording of the locality data.

Some geographically based variation is present within this sub-
species. Specimens from Washington and the Bitterroot Range in
Ravalli County, Montana have the longest perigynia, often reach-
ing 4.3 mm, and are the most distinct from ssp. scirpoidea. Spec-
imens from Alaska, northern British Columbia and the Yukon ex-
hibit tendencies towards ssp. scirpoidea. Fifteen percent of these
plants have perigynia just under 3 mm long (high end of ssp.
scirpoidea range) and perigynia length-to-width ratios over 2.5
(unlike those of ssp. scirpoidea which are less than 2.5 times as
long as wide); they lack the clavate, loosely flowered spikes char-
acteristic of plants of ssp. stenochlaena in Washington and Ravalli
County, Montana. The intergradation observed in plants from Brit-
ish Columbia and elsewhere might be the result of hybridization
between ssp. stenochlaena and ssp. scirpoidea at localities where
their ranges overlap. For this reason, subspecies stenochlaena is
recognized at the subspecific level, rather than the specific level.

REPRESENTATIVE SPECIMENS: Canada. BRITISH COLUMBIA: Bluster Mt., eee
ble Mts., 14 Jul 1938, Thompson & Thompson 455 (CAS, DAO, F, GH, MO,
US, WTU); Chilliwack Valley, 49°10’N, 121°-122°25'W, 12 Jul 1901, pias
33728 (CAN, MO, MSC, NY, US); Katherine Lake, 57°26'N, 126°48’W, 25 Jul

Hollister 43 (NY, US); Mt. Assiniboine Park, Lake Magog, 16 Jul 1937, Rose
37550 (CAS, UC); Mt. Chelam, 15 Aug 1901, Anderson s.n. (MO); Noaxe Lake,
4 Aug 1957, Brink s.n. (DAO, OsU, UBC); Ellis Point & Mercer Point, W of

Jul 1964, Hett & Armstrong 399 (DAO); Mt. Klitsa, 22 Jul 1971, Pojar 1 7}
(UBC); YUKON TERRITORY: Alsek Valley, ca. 8 mi. W of Mackintosh, 5 Jul

& Breitung 1198] (CAN); Canol Road, Mt. Sheldon, 3 Aug 1944, Porsild &
Breitung 11708 (can), 11703 (GH); Kluane Lake, near Rusty Glacier, W of
B Landing, 61°16'N, 140°15’W, 9 Jul 1968, Murray 1671 (can);
Mackintosh, mile 1002, Alaska Hwy., Alsek Valley Road, 4—5 Jul 1957,
Schofield & Crum fs 7560, 7561 (CAN).

United States. ALaska: Charlie River, 64°50’N, 143°40’W, 30 Aug 1956,
Argus 872 (RM, SASK); pentane Range, Tazalina Glacier, 61°45’N, 146°30'W,

1999] Dunlop and Crow—Taxonomy of Carex 193

19 Jul 1957, Viereck 2194 (CAN); Juneau, 10 Jul 1917, Anderson 365 (NY); Mt.
McKinley National Park, 2 mi. N of N entrance, 29 Jul 1967, Hermann 215] a
(MICH, NY); Wonder Lake, Argus 660 (SASK); Mt. Hayes, Palmer 606 (us); M
Roberts, Juneau, 26 Jun 1925, Anderson 2A233 (GH); Yes Bay, 16 Jul (98)
Howell 1705 (CAS, MSC, NY, US); MONTANA: Ravalli Co., Bitterroot National
Forest, Bailey Lake, 22 Aug 1985, Dunlop & Orlando 2272 (NHA); Bitterroot-
Selway Divide above Baily Lake, 12 Jul 1969, Lackschewitz 1344 (NY, RM);
affin Lake Basin, Chaffin Peak, 30 Aug 1971, Lackschewitz 3397 (MONTU);
Sheafman Lake, 17 Aug 1979, Lackschewitz 2317 (MONTU); St. Joseph’s Peak,
31 Jul 1969, Lackschewitz & Fageraas 1631 (MONTU); Tin Cup Lake, 19 Jun
1971, Lackschewitz 2727 (MONTU); Trappers Peak, 14 Aug 1946, Hitchcock &
Muhlick 15381 (CAS, NY, WTU); White Mt., 11 Aug 1970, Lackschewitz & Smith
2277 (MONTU); WASHINGTON: Chelan Co., Crown Point, Holden-Lyman Lake
Trail, 20 Aug 1956, Raven 10176 (cas); Ingalls Peak, 20 Jul 1925, St. John &
Thayer 7239 (ws); Mt. Stuart, 23 Jul 1933, Thompson 9580 (DS, GH, MO, NY,

Olympic Mt., Aug 1895, Piper 2243 (BH, GH, WS); Jefferson Co., Mt. Anderso
28 Jul 1936, Meyer 686 (Mo, ws); King Co., Denny Creek, 19 Aug 1936.
prey e 13684 (CAS, MO, NY, PH, WS, WTU); Guy Peak, Snoqualmie Pass, 7
Aug 1933, Thompson 9690 (Ny, WTU); Kittitas Co., ‘Wecaly Creek Trail, T22N
RISE ca. S1, 17 Aug 1985, Daendois & arcnen 224] (NHA); Fish Lake, 17 Jun
1934, Thompson 10663-4 (CAS, DS, GH, NY, POM, US, WTU, UWT); Okanogan Co.,
Hart’s Pass, ca. 20 mi. E of Diablo, 11 Jul 1971, Douglas 2866 (ALTA); Horse
Shoe Basin, Sep 1897, Elmer 684 (MIN, MO, NY, POM, US, VT, WS); Snohomish
Co., Mt. Pugh, 18 Aug 1938, Thompson 14340 (CAS, GH, WTU); Whatcom Co.,
Crater Mt., 20 Aug 1971, Naas 1240 (RM); Twin Lakes, Jackson Mt., 7 Sep
1927, St. John 8941 (ws, RM); Mt. Shuksan, ca. 22 mi. N of Rockport, 13 Jul
1969, Douglas 1417 (RM).

2. Carex curatorum Stacey, Leafl. W. Bot. 2: 13. 1937. C. scir-
poidea var. curatorum (Stacey) Cronquist, Intermountain
Flora 6: 113. 1977. TYPE: u.s.A. Arizona: Grand Canyon Na-
tional Park, Kaibab Trail to Roaring Springs, 23 Jun 1933,
Eastwood & Howell 1100 (LECTOTYPE: CAS 204972! desig-
nated herein).

Carex haysii Welsh, Mem. N. Y. Bot. Gard. 64: 124. 1990. TyPE: U.S.A.

tah: Washington Co., Zion Canyon, Lower Emerald Pool, Spring-

dale Sandstone, hanging garden, sandy bank and cliff face, ca. 4300

ft. T41S RLOW S9, 5 Jun 1989, Welsh, Clark & Hays 24335 (HO-
LOTYPE: BRY; ISOTYPES: CAS, MICH!, NY!, POM, RM, UT).

Rhizomes short and forming mats. Culms one to several per
node, arising from current year shoots (lacking the withered per-
sistent leaf bases of the previous year), strongly scabrous the full
length of culm. Pistillate culms 0.4—1.2 mm wide at the top, 0.7—

5 mm wide at the base, (23) 35-91 cm tall. Staminate culms

194 Rhodora [Vol. 101

0.5—1 mm wide at the top, 0.9—-4.5 mm wide at the base, 20-74
cm tall. Leaf sheaths of the rhizome and culm bases light brown
to purple-black, glabrous, dull, coriaceous. Leaves of the flow-
ering shoots 2—6, arising from the base and not clustered, adaxial
surface sparsely pilose especially along median adaxial groove
and veins, margins strongly scabrous; in pistillate plants 12—57
cm long, 1.5—2.3 mm wide; in staminate plants 12-25 cm long
and 1.2—-3.1 mm wide. Vegetative leaves 4-11 per shoot; in pis-
tillate plants 14-55 (79) cm long, 1.1—2.3 mm wide; in staminate
plants 18-55 cm long, 1.2-1.9 mm wide; ligules triangular, 1.4—
4.2 (5) mm in height, 1.1—2.3 mm wide. Inflorescences unisexual
(rarely bisexual), not strictly unispicate, (occasionally with 1-2
short lateral spikes of the same sex in the axil of the involucral
bract or subtending the terminal spike), erect or drooping on lax
culms, linear, loosely to densely flowered; pistillate spikes 17—43
mm long, 2.5-5 mm wide, staminate spikes 13-37 mm long, 2—
5 mm wide. Involucral bract usually present, usually single, fo-
liaceous or scale-like, shorter than or equal to length of the inflo-
rescence, 6-11 cm long, base inserted 5-75 mm below spike,
auriculate. Pistillate scales oblong-lanceolate, 2—3.5 mm long,
0.7-1.9 mm wide, half as long as to equaling the perigynia, api-
cally acute, red-brown with narrow to broad hyaline margins;
central midrib narrow, extending to apex, occasionally prolonged
into a short awn; margins entire, sometimes ciliate. Staminate
scales similar to pistillate, 3.5—-4.3 mm long, 1-1.3 mm wide.
Perigynia obovate to ovate, 2-3 (4) mm long, 1.5-1.8 mm wide,
wider than subtending scale, tapering gradually or abruptly con-
tracted to a beak, with few obscure nerves on the adaxial surface
over the achene, marginal nerves evident, pale green to tawny
becoming red-brown towards apex, hirsute with white hairs; body
not tightly enveloping the achene; beak 0.1-0.5 mm long, red-
brown and hyaline at tip, straight at maturity, orifice entire and
adaxially oblique. Achenes dark brown, 1.2-2 mm long, 0.8—1.2
mm wide, stipe 0.25 mm, filling only 4—% the length of the per-
igynia and % the width such that the perigynia sides are com-
pressed and contracted at the base. Rachilla often present. Anthers
1.7—2.4 mm long.

DISTRIBUTION. Carex curatorum is limited to southern Utah and
adjacent northern Arizona (Figure 5), especially along the Colo-
rado and San Juan Rivers and their tributaries.

1999]

Dunlop and Crow—-Taxonomy of Carex

Figure 5. Distribution of Carex curatorum.

196 Rhodora [Vol. 101

HABITAT. This taxon grows in riparian or hanging garden com-
munities, and may have been represented by more populations
before the damming and flooding of the Colorado River. It occurs
on Navajo Sandstone, described as a crossbed of fine-grained
sandstone and gray limestone (Lohman 1975), and on the Kay-
enta Formation, both of which are widespread substrata in south-
ern Utah

Carex curatorum is a distinct southwestern endemic. It is dis-
tinguished by sparsely pilose adaxial leaf surfaces, most obvious

with the scanning electron microscope but visible with a dissec-
tion microscope. Achenes are not tightly enveloped by the peri-
gynia and the pistillate scales are mostly shorter than the peri-
gynia. The scales and perigynia are characteristically lighter in
color than other taxa of section Scirpinae.

Plants flower from April to May. Upon maturity, the perigynia
and enclosed achenes disarticulate from the spikes, and are read-
ily dispersed, unlike Carex scirpoidea which retains achenes and

erigynia sometimes until the next growing season. Maximum
culm height is greater than that of C. scirpoidea, and the achene

Ils only a small portion of the perigynium. The unique achene
micromorphology of C. curatorum and its sparsely pilose adaxial
leaf surfaces segregate it from all other members of section Scir-
pinae.

In naming this species Stacey (1937) selected the epithet ‘‘cur-
atorum”’ to honor Alice Eastwood and J. T. Howell, curators at
the California Academy of Sciences, and the collectors of the type
specimens. Stacey (1937) designated both a staminate and pistil-
late plant, on separate sheets and with different collection num-
bers, to serve as types. The pistillate specimen (Eastwood &
Howell 1100 cas 204973), is selected herein to serve as the lec-
totype, since it possesses the diagnostic features of this taxon.

€ staminate specimen (Eastwood & Howell 1101 cas 204973)

other specimens (Eastwood & Howell 1045 cAs, 1089
cas) collected along with the type remain important original ma-
terial from the type locality.

Carex haysii Welsh, described in 1990, is treated here as a
synonym since all the characters that are said to distinguish it
overlap with C. curatorum except for perigynium length. How-
ever, on many specimens, the longest perigynia of C. haysii
lacked fully formed achenes.

1999] Dunlop and Crow—Taxonomy of Carex 197

REPRESENTATIVE SPECIMENS: United States. ARIZONA: Coconino Co., Gran
Canyon National Park, Kaibab Trail to Roaring Springs, 22 Sep 1938,
wood & Howell 7073 (Cas, F, MICH, MT, NY, POM, UC, US, WTU); Grand Canyon
National Park, False President Harding Rapids, mile 43, 17 Mar 1974, Kar-
piscak & Theroux 94] (ARIZ); Colorado River, Buck Farm Canyon, 40.75 mi.
below Lees Ferry, % mi. above river, 29 Apr 1970, Holmgren, Holmgren &
Ross 15481 (coLo); Mohave Co., Grand Canyon National Monument, aaa
eap Pt., Saddle Horse Springs, 13 Jun 1941, Cottam 8652 (coLo, uid UTAH
Kane Co., confluence of San Juan & Colorado Rivers, on San J ca. %

mi. above second hanging garden on W in side-canyon, 9 Jun 1972. Aiwoed
40a (BRY); Glen Canyon National Recreation Area, Lake Powell, vicinity
rth Escalante, ca. 3800 ft., T40S R9E S36, 28 May 1983, Welsh 22113
ra NY); Long Canyon, Waterpocket Fold, T39S R9E S1, 24 May 1984,
Welsh 22850 (Bry); Coyote Creek Canyon, near Jacob Hamblin Arch, T38S
R8E, 29 Jul 1985, Dunlop & Orlando 2087 (NHA); Glen Canyon Nat. Rec.
Area, Cow Canyon, Waterpocket Fold, T38S R9E $36, 26 Jul 1983, Welsh,
Welsh & Chatterley 22350 (BRY); San Juan Co., Lake Powell, Double Cove
Garden, T40S R9E S25, 3800 ft., 1 Jul 1983, Welsh 22322 (Byu, UT); Lake
Powell, Ribbon Canyon, canyon sides and hanging gardens, T41S RIOE SS,
25 Apr 1983, Welsh 21730 (BRY); Washington Co., Zion Canyon, Lower
Emerald Pool, Springdale Sandstone, hanging garden, sandy bank and cliff
face, ca. 4300 ft., T41S R1OW S9, 5 Jun 1989, Welsh, Clark & Hays 24335
(BRY, CAS, NY, POM, RM UT); Kayenta rhea: ca. 6000 ft., Kolob Section,
hanging garden below Kolob Arch, ca. . SE of Kolob cea visitor
center, T39S R12W S1, 25 May 1989, ha 18499 (BRY, CAS, NY
UTC); Zion Canyon, Weeping Rock, T41S R1OW S82, ca. 4300 ft., 9 Tul ‘1988,
Welsh, Clark & Charlesworth 24059b (BRyY); Zion Canyon, Lower Emerald
Pool, Springdale Sandstone, hanging garden, ca. 4300 ft., T41S RI1OW S9, 2
May 1989, Welsh & Clark 24233 (BRY).

EXCLUDED TAXA

Carex gigas (Holm) Mackenzie, Bull. Torrey Bot. Club 35: 268.
1908. Carex scirpoidea var. gigas Holm, Amer. J. Sci. IV
18: 20. 1904. Type: U.S.A. California: Siskiyou County, Mt.
Eddy (not known).

Carex scabriuscula Mackenzie, Bull. Torrey Bot. Club 35: 268.
1908. TYPE: U.S.A. Wet meadow in the Cascade Mountains,
30 Jun 1902, Cusick 2849 (HOLOTYPE: NY!; ISOTYPES: CU!, Ds!,
ORE!, osc!, POM!, uc!, ws!).

The taxonomic status of Carex gigas and C. scabriuscula, ser-
pentine endemics in California and Oregon, remains problematic.
These two taxa are excluded from section Scirpinae because they
are rarely unispicate, often not dioecious, and do not possess the
pubescence of the perigynia characteristic of the section. Exclu-

198 Rhodora [Vol. 101

sion is further supported by evidence from chromosome numbers,
leaf surface features, and ecology (Dunlop 1990).

ACKNOWLEDGMENTS. We would like to thank the curators of
the following herbaria for loans: AA, ARIZ, ALA, ALTA, ASC, BH,
BYU, CAN, CAS, COLO, CS, DAO, DAV, DS, F, HSC, MAINE, MASS, MBG,
MICH, MIN, MONTU, MSC, MT, NA, NY, OS, ORE, OSC, PAC, POM, RSA,
RM, SASK, ble UBC, UC, US, UT, USAS, USFS, VT, WAT, WILLU, WIS,

e thank A. L. Bogle, T. D. Lee, A. A. Reznicek, L.
x pits J. R. Sullivan, M. Wirth, and E. G. Voss for advice
and/or comments on this manuscript. This work was submitted
to the University of New Hampshire by D.A.D. in partial fulfill-
ment for the requirements of a doctorate degree. Research, field
work, and/or publication preparation was supported by the fol-
lowing: an Andrew Mellon Fellowship to the Naturalist-Ecologist
Training Program at the University of Michigan, two grants from
the University of New Hampshire Central University Research
Fund, a Graduate School Dissertation Fellowship from the Uni-
versity of New Hampshire, a graduate student travel award from
the New England Botanical Club, Sigma Xi Grant-in-Aid of Re-
search, a Gilmore Grant from New England College, and support
from the New Hampshire Agricultural Experiment Station. This
paper is Scientific Contribution Number 1974 from the New
Hampshire Agricultural Experiment Station.

LITERATURE CITED

BAILEY, L. H. 1887. A ne synopsis of North American Carices. Proc.
Amer. peer Arts 22: 1-157.
pices bs M. AND V. R. nea: 1995. A review of the alvars of the
hake region: Distribution, floristic eit biogeography
sd protection Canad. Field-Naturalist 109: 143-
Crins, W. J. AND P. W. BaLL. 1989. Taxonomy of te Het flava complex
(Crveschnaiigls in North America and northern Eurasia. I. Taxonomic
eatment. Canad. J. Bot. 67: 1048-1065.
fines D. A. 1990. The biosystematics of Carex section Scirpinae (Cyper-
aceae). Ph.D. dissertation, Univ. New Ham pshire, Durham, NH.
, 7. Taxonomic changes in Carex (section Scirpinae, Cyperaceac).
Novon 7: 355-356
HERMANN, F. J. 1957. New ome from the Canadian Rocky Mountains.
Leafil. W. Bot. 8: 109-
ok tues ed ise oO Cyperaceae. XXII. The Cyperaceae of the
Chilliwack Valley, British Columbia. hail J. Bot: Ser. 4, 18: 12-22.
Sicheemeas V. 1935. Carex. In: V. L. Komarov, ed., Flora of the USSR

1999] Dunlop and Crow—Taxonomy of Carex 199

3: 111-464. (English translation by N. Landau, Smithsonian Institute
d the National Science Foundation, 1964. 3: 86-369).
KUKENTHAL, G. 1909. Cyperaceae—Caricoideae. Das Pflanzenreich 4(20): 1-

LOHMAN, S. W. 1975. The Geologic — eis Arches National Park. U.S. Dept.
Interior, Geologic Survey Bulletin

MACKENZIE, K. K. 1908. Notes on ra i Torrey Bot. Club 35: 266—
270

1935. Cyperaceae—Cariceae. N. Amer. Fl. 18: 1-478.
eee A. 1803. Flora Boreali-Americana. Vol. II. Facsimile Edition,
1974. Hafner Press, New Yor
NELMES, E. 1951. Facts and speculations on phylogeny in the tribe Cariceae
of the pigs I. Sem. considerations. Kew Bull. 1951: 427—436.
Snes H. AND M. Dum 1941. A new species of Carex and some notes
this eae in pis ‘Coa Rhodora 43: 413-425.
PAX, EA ea Bias Carex. In: A. Engler and K. A. Prantl, eds., Nat. Pflanzen-
n 2(2). W. Englemann, Leipzig.
petites ae A. 1990. Evolution in sedges (Carex, Cyperaceae). Canad. J.
Bot. 68: 1409-1432.
RypsBerG, P. A. 1900. Catalogue of the Flora of ee and the Yellowstone
National Park. Mem. New York Bot. Gard. 1: 78.
STACEY, J. W. 1937. Notes on Carex VII. Leafi. i Bot. 2: 13-15.
STAFLEU, E A. AND R. S. Cowan. 1979. Taxonomic Literature, Vol. I. H—
Le. Regnum Veg. Vol. 98. Bohn, Scheltema & Holkema, Utrecht.
STANDLEY, L. A. 1985. Systematics of the Acutae group - och (Cypera-

pane <ageeeh County, Michigan, pp. 56-60. In: Richard Brewer, ed.,
the Eighth North American Prairie Conference. Kalamazoo,
thicuctgsane - 1843. Enumeratio Methodica Caricum Quarundam. Isaacus
Riggs, Schenectady, NY.
WELsH, S. L. 1990. Utah novelties in Carex ee oe and Lomatium
(Umbelliferae). Mem. New York Bot. Gard. 64:

RHODORA, Vol. 101, No. 906, pp. 200-205, 1999

NEW ENGLAND NOTE

RARE AND NON-NATIVE PLANTS OF
MASSACHUSETTS’ FLOODPLAIN FORESTS

JENNIFER B. KEARSLEY
Massachusetts Natural Heritage & Endangered Species Program,
Massachusetts Division of Fisheries & Wildlife, Route 135,
Westborough, MA 01581

Six rare plant species occur primarily in floodplain forest com-
munities in Massachusetts: Arisaema dracontium, Betula nigra,
Carex grayi, C. typhina, Mimulus alatus, and Rumex verticillatus.
Two of the species, M. alatus and B. nigra, are identified as
regionally rare taxa (Division 2) on the Flora Conservanda: New
England list (Brumback and Mehrhoff, et al. 1996), and all except
B. nigra are protected species under the Massachusetts Endan-
gered Species Act (Massachusetts Division of Fisheries and Wild-
life 1997). In a statewide inventory and vegetation classification
of Massachusetts’ floodplain forest communities (Kearsley 1999),
all six rare plant species were found to occur primarily in two of
six identified community types: Transitional floodplain forests—
Acer saccharinum—Arisaema dracontium association (Type III)
and Small-river floodplain forests—A. saccharinum—Fraxinus
pennsylvanica—Quercus palustris association (Type IV). Flood-
plain forest communities of Types III and IV appear to be less
severely scoured and more poorly drained than Major-river types
(Types I and II), but more well-drained than seasonally flooded
A. rubrum Alluvial swamp forests (Type V).

In the Massachusetts floodplain forest inventory, Arisaema
dracontium occurred primarily in floodplain forests classified as
Type III. All current floodplain forest localities of A. dracontium
are limited to the Connecticut, Deerfield, and Housatonic Rivers.
Eleven of the thirty sites examined in the inventory and classi-
fication project that occur on the Connecticut, Deerfield, or Hou-
satonic Rivers had vegetation classified as Type III, and A. dra-
contium occurred at six of those sites. All plots classified as Type
{II in the TWINSPAN analysis were clustered together with and
without A. dracontium included in the analysis.

Arisaema dracontium did not occur at the nineteen sites on the
Connecticut, Deerfield, and Housatonic Rivers with vegetation

200

1999] New England Note 201

not classified as Type III, with the exception of one site on the
Mill River in Northampton classified as a Small-river floodplain
forest (Type IV). In addition to the six A. dracontium localities
surveyed in 1997, six other current localities of A. dracontium
are tracked in the Massachusetts Natural Heritage and Endan-
gered Species Program (MNHESP) Biological and Conservation
Database. These six sites were not included in the floodplain for-
est inventory because they are small and/or disturbed floodplain
forest patches, but the associated species (Acer saccharinum,
Fraxinus pennsylvanica, and Ulmus americana over a mixed her-
baceous understory of Boehmeria cylindrica, Laportea canaden-
sis, Pilea pumila, Onoclea sensibilis, and Matteuccia struthiop-
teris) closely match the species association of Type III floodplain
forest communities.

The results of the floodplain forest inventory support Sanders’
(1989) earlier findings that Arisaema dracontium populations oc-
curred on Limerick and Hadley silt loams, but not on adjacent
Winooski silt loams or Suncook loamy, fine sands along the Con-
necticut River. They also suggest that efforts aimed at locating
and protecting A. dracontium populations should focus on Tran-
sitional floodplain forest communities (Type II

Carex grayi, C. typhina, Mimulus alatus, and Rumex verticil-
latus were all found to occur primarily in floodplain forest sites
classified as Type IV, which are characterized by a mixture of
Acer saccharinum, Fraxinus pennsylvanica, and Quercus palus-
tris over an open understory dominated by Onoclea sensibilis and

oehmeria cylindrica (Kearsley 1999). Sorrie (1987) previously
described C. grayi as occurring in F. pennsylvanica—A. sacchar-
inum—Q. palustris—Populus deltoides floodplain forests of the
Connecticut and Housatonic Rivers. Of the twelve sites with veg-
etation classified as Small-river floodplain forests (Type IV;
Kearsley 1999), four are current localities of C. typhina, two of
the four sites are also localities for C. grayi and M. alatus, and
one of the four provides habitat for all four rare plant species.
Floodplain forest sites with vegetation not classified as Type IV
generally did not contain these four rare plant species, with the
following exceptions: two Transitional floodplain forest commu-
nities (Type III) on the lower Sawmill River in Montague and on
the lower Housatonic River in Sheffield, which are current lo-
calities for C. typhina and C. grayi, respectively, one Alluvial
terrace forest—A. rubrum—Carya ovata—Prunus serotina associ-

202 Rhodora [Vol. 101

ation (Type VI) on the Nashua River, which is a current locality
for C. typhina, and the wet borders of a floodplain forest mosaic
classified as both Types II and III on the Connecticut River in
Longmeadow, Massachusetts, which is a current locality of R.
verticillatus.

Current rare plant records compiled by MNHESP indicate that
Carex grayi, C. typhina, Mimulus alatus, and Rumex verticillatus
also occur in other floodplain communities not included in the
recent inventory. These data provide further information about
the habitat preferences of these species. Carex grayi occurs at
five sites not included in the floodplain forest inventory—three
sites are small patches of floodplain forest with vegetation asso-
ciations that are most similar to Types III and IV, and two sites
(on the Connecticut and Housatonic Rivers) have vegetation as-
sociations most similar to Alluvial terrace forests (Type VI), in-
dicating that C. grayi may be found in all three floodplain forest
habitats (Types III, IV, and VI). Carex typhina is found at one
disturbed floodplain forest site not included in the inventory, but
with vegetation most similar to Types III and IV. All current
localities of C. typhina appear to be limited to Types III, IV, and
V with most occurring in Type IV forests (five of nine current
localities).

Mimulus alatus is known from two localities not included in
the floodplain forest inventory, both are at the edges of small
tributary creeks along the Connecticut River. The vegetation at
these sites is most similar to that of Type IV Small-river flood-
plain forests, and M. alatus appears to be limited to low-energy
stream bottoms of the Connecticut River Valley. Rumex verticil-
latus was found at two floodplain forest sites included in the
current inventory: one at the border of a meander scar pool in a
Small-river floodplain forest (Type IV) and one in the open, sea-
sonally flooded borders of a large floodplain forest mosaic clas-
sified both as Major-river floodplain forest (Type II) and as Tran-
sitional floodplain forest (Type III) in depressions. Rumex verti-
cillatus is known from two other localities in the state, a vernal
pool complex and an emergent marsh, indicating that R. verticil-
latus is not strictly associated with a particular floodplain forest
community, but rather with seasonally or semi-permanently in-
undated wetlands that can be associated with floodplain forests.

Betula nigra, which is a primarily southern tree, has a disjunct
population in the Merrimack River Valley of southeastern New

1999] New England Note 203

Hampshire and northeastern Massachusetts (Burns and Honkala
1990). In Massachusetts, B. nigra is limited to sites on the Con-
cord, Shawsheen, and Merrimack Rivers where it occurs as a
riverbank tree in a narrow band along the Merrimack River, as
an occasional associate within Alluvial swamp forests (Type V)
or as the dominant tree in Small-river floodplain forests (Type
IV; Kearsley 1999). In areas along the Shawsheen River in Essex
County that appear to have been cleared, B. nigra occurred in
dense thickets (10-30 cm diameter at breast height) over a sub-
canopy of Acer saccharinum oii suggesting that B. nigra
may be replaced by A. saccharinu

Of the 214 species identified in perme forest communities
during the 1997 inventory (Kearsley 1999), 36, or 17%, were
non-native. The most frequently encountered non-native plant
species across all types were Rhamnus frangula, Rosa multiflora,
Celastrus orbiculata, Alliaria petiolata, Glechoma hederacea,
Lysimachia nummularia, Lythrum salicaria, Myosotis scorpioi-
des, and Polygonum cuspidatum. There were clear distributional
patterns of non-native plant species across Massachusetts’ flo
plain forest communities. Alliaria petiolata, G. hederacea, ie
P. cuspidatum were more prevalent on coarse-textured alluvial
soils of Major-river floodplain forests (Types I and II). Polygo-
num cuspidatum was most often found on open, heavily-scoured
banks, but it also occurred in dense monocultures in open areas
within the interior forest. Preventing further canopy openings may
be the only effective way to prevent the spread of P. cuspidatum
in Major-river floodplain forests (Beerling et al. 1994). Alliaria
petiolata and G. hederacea were found mainly along trails and
did not appear to be spreading where the natural understory veg-
etation was intact. These two species were also the two most

ommon exotic plant species in a study of the Potomac River
feciadlatn forests in Virginia and Maryland (Pyle 1995).

Rhamnus frangula, Celastrus orbiculata, Lysimachia nummu-
laria, Myosotis scorpioides, and Lythrum salicaria were more
common on poorly-drained silt loams in the eastern part of Mas-
sachusetts (Types IV, V, and VI; Kearsley 1999). Lysimachia
nummularia, M. scorpioides, and R. frangula covered broad areas
at some sites. In two permanent plots monitored by the Massa-
chusetts Audubon Society along the Ipswich River, the cover of
L. nummularia, R. frangula, L. salicaria, and M. scorpioides in-
creased by 50% and 83%, respectively over a six year period

204 Rhodora [Vol. 101

(Anderson 1993). More studies are needed to monitor the spread
of these taxa.

Although Lythrum salicaria is one of the most invasive wet-
land plants in the Northeast (Stein and Flack 1996), L. salicaria
is largely absent from floodplain forest communities in Massa-
chusetts. It occurred only along the wettest riverbanks in eastern
Massachusetts and on sandy beaches on the Connecticut River.
Catalpa speciosa has been reported to be increasing in abundance
in at least one Connecticut River floodplain forest (Burk and Pra-
bhu 1988), and we observed the trees in low but consistent num-
bers in floodplain forests of Types II, II, and IV (Kearsley 1999).

ACKNOWLEDGMENTS. I thank Paul Somers for his critical re-
view of this note. Information on Massachusetts occurrences of
state-protected rare species was obtained from the Massachusetts
Natural Heritage and Endangered Species Program (MNHESP)
Biological and Conservation Database. Multiple people assisted
with the floodplain forest community inventory as acknowledged
in Kearsley (1999). In particular, I would like to thank Pat Swain,
Rebecca Anderson, Henry Woolsey, and the MNHESP staff. The
floodplain forest inventory and classification work was in part
funded by a State Wetlands Protection Development Grant from
the U.S. Environmental Protection Agency.

LITERATURE CITED

ANDERSON, J. 1993. Invasion of the sanctuaries. Sanctuary (publ. of Mass.
Audubon Soc.) Jan/Feb: 25.

BEERLING, D. J., J. BP. BAILEY, AND A. P. ConoLLy. 1994. Fallopia japonica
(Houtt.) Ronse Decraene. J. Ecol. 82: 959-979.

BRUMBACK, W. E. AND L. J. MEHRHOFF, in collaboration with R. W. ENSER,
S. C. GAWLER, R. G. Popp, P. SoMERS, AND D. D. SPERDUTO, with assis-
tance from W. D. COUNTRYMAN AND C. B. HELLQuIsT. 1996. Flora con-
servanda: New England. The New England plant conservation program
pe pe list of plants in need of conservation. Rhodora 98: 233—361.

Burk, C. J. AND V. PraBHu. 1988. Growth an expansion of a naturalized
poses peselidiia stand of Catalpa speciosa Warder. Rhodora 90:
457-460.

Burns, R. M. AND B. H. HONKALA, tech. eds. 1990. Silvics of North America:
2. Hardwoods. Agriculture Handbook 654. U.S. Department of Agricul-
ture, Forest Service, Washington
KEarSLEY, J. 1999. Inventory and vegetation classification of floodplain forest
communities in Massachusetts. Rhodora 101:105—135.

1999] New England Note 205

MASSACHUSETTS DIVISION OF FISHERIES AND WILDLIFE. 1997. Massachusetts
Endangered Species Act Regulations, 321 CMR 10.60. 114-133.

Pye, L. L. 1995. Effects of disturbance on herbaceous exotic plant species
on the floodplain of the Potomac River. Amer. Midl. Naturalist 134: 244—

SANDERS, L. L. 1989. On the occurrence of Arisaema oni pains in Hamp-
hire County, Massachusetts. Rhodora 91: 339-3

SorrigE, B. 1987. Notes on the rare flora of bein Rhodora 89; 113—
196

STEIN, B. A. AND S. R. FLACK, eds. 1996. America’s Least Wanted: Alien
Species Invasions of US Ecosystems. The Nature Conservancy, Arlington,
VA.

RHODORA, Vol. 101, No. 906, pp. 206-207, 1999
BOOK REVIEW

Wild Orchids Across North America: A Botanical Travelogue by
Philip E. Keenan. 1998. 340 pp. illus. ISBN 0-88192-452-0
$39.95 (hardback). Timber Press Inc., Portland, OR.

Wild Orchids Across North America is an intensely personal
account of author Philip Keenan’s love for our native orchids. His
color photography has portrayed the alluring qualities of these
plants so well it seems only the fragrance is missing. Many of
the close-ups reveal not only the details of form and color, but
have captured that crystalline quality of the floral tissue that adds
an indefineable measure of beauty to the flowers of these exqui-
site plants. In this book, the author reminds us why we love
plants. Orchids and orchid photography are food for the soul.

In an age of increasingly technical botanical books, the author
has chosen instead to recount the main field trips he has taken in
the past thirty years, often with friends and colleagues, in order
to make his personal acquaintance with the orchids on this con-
tinent. In the thirty-eight short chapters we come to a fuller ap-
preciation of the natural variation, ecology, and geographic dis-
tribution of North American Orchidaceae, but this is not, by any
means, the whole story. Through orchids we come to understand
much about the author himself. He is romantic. In chapter nine
he describes the day he finds Corallorhiza striata near the base
of a beautiful moss-covered limestone ledge on Flowerpot Island,
off the Bruce Peninsula in the Great Lakes, and hastens to set up
his tripod and camera. Then he “waits for a shaft of sunlight to
penetrate a crack in the canopy, and transform, ... what a mo-

206

1999] Book Review 207

natural beauty of the living world around us. This is a book that
kindred spirits will savor.

The author has included more than 170 color photos to illus-
trate 82 of the 145 species of orchids native to North America
excluding Mexico and Florida. Twenty-three of the thirty-five na-
tive genera are illustrated including 11 of the 14 species of Cyp-
ripedium, 7 of the 8 species of Listera, and 17 of the 30 species
of Platanthera. For many species, such as Arethusa bulbosa, Cal-
opogon tuberosus, Galearis spectabilis, Cypripedium reginae,
and Triphora trianthophora, there are photographs of the rare
color forms often sought by orchid enthusiasts. These images are
especially welcome as this type of information is not well pre-
served in traditional herbarium specimens.

This book will not only set a new standard for orchid photog-
raphy, but it will serve as an excellent companion to the technical
manuals that amateurs and professionals must ultimately use to
identify members of the taxonomically difficult species groups
such as the orange fringed- and the purple fringed-orchids in the
genus Platanthera, the yellow lady’s-slippers or Cypripedium
parviflorum complex, and the ladies’ -tresses belonging to the Spi-
ranthes cernua complex. The photographs and discussions of
these hybrid complexes will provide many useful benchmarks to
those beginning to explore the diversity in these species groups.

—Davip S. Conant, Department of Natural Sciences, Lyndon
State College, Lyndonville, VT 05851.

RHODORA, Vol. 101, No. 906, pp. 208-212, 1999
NEBC MEETING NEWS

January 1999, ‘Proactive Wetland Restoration in Massachu-
setts’” was presented by Charles Katuska of the Massachusetts
state government’s Executive Office of Environmental Affairs
(EOEA). The objective of his talk was to discuss wetland resto-
ration aspects of the state’s Wetlands Restoration and Banking
Program ( P), which began in March, 1994, as an effort to
implement the state’s policy of ‘‘no net loss of wetlands in the
short-term and a net gain in the long-term.”’ Katuska explained
that wetlands constitute 12% of the state’s land area or about

,000 acres. Of these acres, about 20% represent salt water
wetlands, including 45,000 acres of tidal flats. Massachusetts wet-
lands were once more abundant. He said about 28% of the state’s
wetlands at the time of colonization have been lost due to filling,
draining, and other human activities. He started by explaining the
program’s definition of wetland restoration: ‘‘The act, process or
result of returning a wetland or a former wetland to a close ap-
proximation of its condition prior to the disturbance.”’ Thus, the
restoration result would not be necessarily a totally pristine wet-
land; the area could possess invasive species and still be consid-
ered restored. He recognized two types of restoration, the first
being “the reestablishment of a wetland or former wetland on
what is now a nonwetland site,”’ and the second being “‘the return
of a damaged, degraded, or functionally impaired wetland to its
predisturbance condition.’’ Examples of restoration actions in-
clude restoring tidal flow, removing fill or dikes, regrading, plant-
ing wetland vegetation, and controlling invasive species. Phrag-
mites control, thus far, has been a major activity of the WRBP.
They have been working with coastal communities, in particular,
where loss of the normal tidal influence has resulted in Phrag-
mites overtaking Spartina in the tidal marshes, and they are now
finalizing a Phragmites control strategy Paper.

To accomplish their objectives, the two person staff of WRBP
works with many other agencies, organizations, and individuals.
To help cement such relationships, the state EOEA, along with a
number of federal and state agencies, signed a joint resolution in
June, 1994, committing to the restoration of Massachusetts wet-
lands. Along with the signatories, they have since formed an al-
liance with nearly 200 other agencies, organizations, and individ-
uals who have agreed to work together toward implementing the

208

1999] NEBC Meeting News 209

Commonwealth’s ‘“‘no net loss” Action Plan. A premise of the
plan is that it is better to treat wetlands as part of a watershed
than as isolated landscape features, thus ‘“‘watershed wetland res-
toration plans” are being prepared, as well, with the assistance
of members of the above ‘“‘Partnership.”” Through WRBP, the
U.S. Army Corps of Engineers has developed a site identification,
data collection, and site screening analysis at the watershed scale.
Using aerial imagery and other data, potential wetland restoration
sites are identified and characterized, then the potential restoration
projects are analyzed to determine their ability to positively in-
fluence wetland functions and the watershed as a whole. This
technical analysis is based on simple functional predictors (size,
position on the landscape, soil characteristics, hydroperiod, etc.)
and assessment of ‘“‘the watershed’s functional deficits” in terms
of water quality, flood storage, and fish and wildlife habitat. In-
dividual site characteristics considered in the analysis also include
factors such as ownership, cost, and likely difficulty of restoration
efforts. The Neponset River watershed serves as the first test or
pilot project for this watershed-based planning approach. In this
watershed alone, 159 potential restoration sites were initially
identified by the Corps in the preliminary assessment and six
general goals for wetland restoration were established, including
control of invasive species. Interestingly, when a draft plan for
Neponset was reviewed by the citizenry, they identified “‘stream
baseflow and groundwater recharge”’ as an additional watershed
goal, as well as identifying 12 additional potential wetland res-
toration sites. Plans for six other watersheds (Otter River, Pas-
kamanset River, Upper Ipswich, Shawsheen, Upper Blackstone,
and Connecticut River) are in the works, as well as salt marsh
inventories along the coast.

The intent of the WRBP is to have implementation of resto-
ration projects locally driven. Thus they do alot to encourage
proposals and funding of projects. One way is through the
GROWetlands initiative whereby they seek and accept project
nominations. The WRBP then helps with technical support, co-
ordination, permitting, access to its read-only database of other
wetland restoration projects, and funding. Katuska finished with
an invitation to the NEBC to help, especially with invasive plant
projects, and then offered handouts describing WRBP, GROWet-
lands, and 25 funding sources available for wetland restoration
projects in the Commonwealth.

210 Rhodora [Vol. 101

February 1999. The speaker for the evening was Dr. Janet Sul-
livan, Editor-in-Chief of Rhodora and adjunct faculty in botany
at the University of New Hampshire, who addressed the topic,
‘Reflections on 100 years of Rhodora.”’ Janet’s talk began with
Volume 1, Number 1 of Rhodora dated January, 1899. The Ed-
itor-in-Chief was Benjamin Lincoln Robinson and Associate Ed-
itors were Frank Shipley Collins, Merritt Lyndon Fernald, and
Hollis Webster. Subscribers each paid a dollar for a dozen issues
the first year. The stated purpose of the journal was ‘to give new
stimulus and render material aid to the study of our local flora.”
Unlike today, the editors announced in the first issue that con-
tributors could follow their own preferences regarding nomencla-
ture and punctuation. All four members of the editorial commit-
tee, especially M. L. Fernald, were frequent contributors the first
year and for many to follow. The early issues contained mostly
short articles and notes, reports and historical accounts of other
botanical clubs such as the Josselyn and the Connecticut Botan-
ical Clubs, upcoming events, and appeals for information on the
region’s flora.

The idea for the journal, Sullivan explained, arose shortly after
the Club’s first meeting in February, 1896. The described purpose
of the Club and its meetings was to provide for social discourse
and the dissemination of information among gentlemen interested
in the flora of New England. A specific goal, to create a checklist
of the New England flora, helped lead the way to establishment
of the journal. In the fall of 1897, the Club reproduced Collins’
list of algae using a hectograph process, which involved writing
on a gel pad which was printed using aniline dye, somewhat like
the later mimeograph process. Members of the Club then began
investigating the possibility of a journal. In February, 1898, Rob-
inson’s Publication Committee reported that the cost of publishing
a monthly journal of about 16 pages each issue would be about
$550 per year, and recommended that the cost of plates be sup-
ported by “‘dignified ads,” thus making them free to the authors
and subscribers. E. L. Rand recommended a minimum of 400
subscriptions would be necessary to support the journal. A cir-
cular was distributed to members in April, 1898, requesting that
resident members in the Boston area each solicit ten subscriptions
and nonresidents each obtain five. This resulted in 450 subscrip-
tions and the journal was launched in earnest. Debate ensued over
the name for the new journal. Robinson stated that the name

1999] NEBC Meeting News 211

should be a ‘“‘distinct and euphonious one-word title.”’ Rand, in
botanical jest, suggested the name Taxus; other suggestions were
Oakesia and Bigelovia. The name Rhodora was suggested but
considered “‘too sentimental’? by some, presumably because of
Emerson’s poem by the same title. In the end, however, there
were 15 votes for Rhodora and 11 votes for all other names
suggested. The name was presented to the Club at the November,
1898, meeting. Subscriptions had increased to around 600 and
the Club had launched its journal to reach “‘the botanical world,
who knows us not.”

Once the journal was established, Collins’ paper on algae and
others, such as one by Walter Deane, presenting New England’s
state by state distribution of taxa in the Ericaceae, began to ap-
pear. Costs, however, were higher than originally estimated, due
mainly to indexing and electrographic printing costs, and the Club
ran a deficit for several years. More ads were included to defray
the cost of plates, an item deemed essential to attract and hold
subscribers. Ads in the early volumes represented nurseries, book-
sellers, personal herbaria, and field guides. Following the Club’s
July, 1900, ‘‘excursion” to Mt. Katahdin in Maine and an account
of it in Volume 3 by Joseph R. Churchill, an ad appeared offering
‘*To Katahdin on horseback.” Other ads offered to guide readers
to rare plant locations. Controversy over the latter led to ads being
dropped in 1907. In 1912, subscription prices were raised to $1.50
per year. An obstacle to printing Volume 2 arose when a fire
destroyed the press where it was to be printed. At the time, how-
ever, the page proofs were being circulated to authors and the
plates were being stored in a vault, so only a three-week delay
occurred.

In the early volumes the editors were also major contributors
as authors. In the first volume, for instance, they contributed 28%
of the articles. M. L. Fernald alone contributed 15 articles. Even
today, he ranks as the most prolific writer in the pages of the
journal. In one year he wrote 25 articles and notes, and over a
52-year span from 1899 to 1950 he averaged 13 contributions per
year. His role as Associate Editor continued until 1928 when he
became Editor-in-Chief, a position he held until 1950. “‘Could it
have survived without his energy?”” some have asked. Gradually,
though, the authorship did diversify. In his thirty-year review ar-
ticle published in 1929, Fernald noted that 399 botanists had con-
tributed to the pages of Rhodora thus far.

212 Rhodora [Vol. 101

Reed Rollins succeeded Fernald as Editor-in-Chief. In 1962,
when Rollins eventually resigned, Albion Hodgdon from the Uni-
versity of New Hampshire became the first Editor-in-Chief from
outside Boston, the journal became a quarterly publication with
a subscription cost of $6.00. Another milestone occurred in 1996
when our speaker, Janet Sullivan, became the tenth, and first fe-
male Editor-in-Chief, particularly notable because women were
not admitted to the Club until 1968. The journal itself continues
to serve botanists of New England but has broadened its read-
ership and geographic scope to an international level, something
that actually began as early as 1919, when E S. Collins published
an article on marine algae of China.

—PAuL Somers, Recording Secretary.

INFORMATION FOR CONTRIBUTORS TO RHODORA

Submission of a manuscript implies it is not being considered for
publication simultaneously elsewhere, either in whole or in part.

TITLE, AUTHOR(S), AND ADDRESS(ES): Center title, in capital
letters. Omit authors of scientific names. Below title, include au-
thor(s) name(s), affiliation(s), and address(es). If ‘current address”
is different, it should follow immediately below, not as a footnote.

FLORAS AND TAXONOMIC TREATMENTS: Specimen citation
should be selected critically, especially for common species of broad

213

214 INFORMATION FOR CONTRIBUTORS

distribution. Keys and synonymy for systematic fee should be
prepared in the style of ‘““A Monograph of the Genus Malvastrum,”
S. R. Hill, RHODORA 84: 159-264, 1982. fe aes of a new
taxon should carry a Latin diagnosis (rather than a full Latin descrip-
tion), which sets forth succinctly how the new taxon differs from its
congeners.

FIGURES: Illustrations must be either black and white half-tones
(photographs), drawings, or graphs. Illustrations must be camera-
ready; flaws cannot be corrected by the Editor or the printer. Add
symbols or shading with press-on sheets. The printed plate will be
4 X 6 inches; be sure that illustrations are proportioned to reduce
correctly. Allow space for a caption, if possible. Magnification/re-
duction values should be calculated to reflect the actual printed size.
Maps must indicate scale and compass direction. The double-spaced
list of legends for figures should be provided on a separate page.
Each figure should be cited in the text in numerical order.

THE NEW ENGLAND BOTANICAL CLUB
22 Divinity Avenue
Cambridge, MA 02138

To join, please fill out this membership application and send
with enclosed dues to the above address.

Regular Member $35.00
Family Rate $45.00
Student Member $25.00

For this calendar year
For the next calendar year ean

Name

Address

City & State Zip

Phone FAX
email —__ EEE

Special interests (optional):

THE NEW ENGLAND BOTANICAL CLUB
Elected Officers and Council Members for 1999—2000:

President: David S. Conant, Department of Natural Sciences,
Lyndon State College, Lyndonville, VT 05851
Vice-President (and Program Chair): Lisa A. Standley, Vanasse
Hangen Brustlin, Inc., 101 Walnut St., PO. Box 9151, Wa-
tertown, MA 02272
Corresponding Secretary: Nancy M. Eyster-Smith, Department
of Natural Sciences, Bentley College, Waltham, MA 02154-
4705
Treasurer: Harold G. Brotzman, Box 9092, Department of Bi-
ology, Massachusetts College of Liberal Arts, North Adams,
MA 01247-4100
Recording Secretary: Paul Somers
Curator of Vascular Plants: Raymond Angelo
Assistant Curator of Vascular Plants: Pamela B. Weatherbee
Curator of Nonvascular Plants: Anna M. Reid
Librarian: Leslie J. Mehrhoff
Councillors: W. Donald Hudson, Jr. (Past President)
Arthur V. Gilman 2000
Karen B. Searcy 2001
David Lovejoy 2002
Jennifer Forman (Graduate Student Member) 2000

Appointed Councillors:
avid E. Boufford, Associate Curator
aks R. Sullivan, Editor-in-Chief, Rhodora

QK |
RAPS

RHODORA

Journal of the
New England Botanical Club

CONTENTS

Notes on Acalypha (Euphorbiaceae) in North America. Geoffrey A. Levin ..... 217

The ps . of Vaucheria (Tribophyceae, Chrysophyta) from
it. Craig W. Schneider, Christopher E. Lane, and Anna

ay 234
Disturbance as a factor in the distribution of sugar maple and the invasion
of Norway maple into a modified woodland. Rebecca Anders : 264
Cardamine georgiana (Brassicaceae), a new name replacing Dentaria
microphylla. Ihsan A. Al-Shehbaz and Suzanne I. Warwick .......... 274
Covariance of lichen and vascular plant floras. James P Bennett and
Cliffe | Wetmore ZEr
NEW ENGLAND NOTES
Notes on the habits and life-history of Bidens nowaslene An epiphyte in
Massachusetts roan ponds. Matthew G. Hickler .............. 298
A new Barnstable County, MA, record for Panes purpurascens.
Donald G. ea Mario J. DiGregorio, and Pamela Polloni ...... 300
Cyperus microiria: A new addition to the flora of Connecticut. Tad M.
Zebryk 302
BOOK REVIEWS
Proceedings of a Symposium on the Recovery and Future of the North-
eastern Forest, Connecticut College, April 12, 1997 ................ 303
Discovering the Unknown Landscape: A History of America’s Wet-
lands 306
Flora of Maine: A Manual for Identification of Native and Naturalized
Vascular Plants of Maine 309
NEBC MEETING NEWS 311
ANNOUNCEMENTS
New England Botanical Club Graduate Student Research Award ........ 318
Humboldt Field Research Institute Prize 319
Information for Contributors 320
NEBC Membership Form 322
NEBC Officers and Council Members inside back cover
Vol. 101 Summer, 1999 No. 907

Issued: October 1, 1999

The New England Botanical Club, Inc.

22 Divinity Avenue, Cambridge, Massachusetts 02138

RHODORA

JANET R. SULLIVAN, Editor-in-Chief

Department of Plant Biology, ereapel of New Hampshire,
urham, NH 03824

ANTOINETTE P. HARTGERINK, Managing Editor

Department of Plant Biology, University of New Hampshire,
Durham, NH 03824

Associate Editors

HAROLD G. BROTZMAN STEVEN R. HILL
DAVID S. CONANT THOMAS D. LEE
GARRETT E. CROW THOMAS MIONE

N. GANDHI—Latin diagnoses and nomenclature

SS is a journal of botany devoted primarily to the flora of North
America. Monographs or scientific papers concerned with systemat-
ics, faa ecology, paleobotany, or conservation biology of the
flora of North America or floristically related areas will be considered.

pee ap mein with the International Association for Plant Taxonom

r the purpose of registration of new names of vascular plants (ex-
adits fossils).

SUBSCRIPTIONS: $75 per calendar year, net, postpaid, in funds paya-

le at par in United States currency. Remittances payable to RHO-
DORA. Send to RHODORA, P.O. Box 1897, Lawrence, KS 66044-
8897.

MEMBERSHIPS: Soe $35; Family $45; Student $25. Application

form printed her

NEBC WEB SITE: Information about The New England Botanical Club,

DORA is available at at http: rosea herbaria. harvard.edu/nebc/

BACK ISSUES: Questions on oo of back issues should be ad-
dressed to Dr. Cathy A. Paris, Department of Botany, University of
Vermont, Burlington, VT 05405- 0086. E-mail: cparis@moose.

edu.

ADDRESS CHANGES: In order to receive the next number of RHO-
DORA, changes must be received by the business office prior to the
first day of January, April, July, or October.

. a «ft ARIANA Sa oe cA te

This Pere ts the ~' we VV [fF Sai Vi of Paper).

RHODORA, Vol. 101, No. 907, pp. 217-233, 1999
MISSOURI BOTANICAL

NOTES ON ACALYPHA (EUPHORBIACEAE) IN
is

H AMERICA OCT 06 1999

GEOFFREY A. LEVIN

Center for Biodiversity, Illinois Natural History Surve BARDEN LIBRARY
607 East Peabody Drive, Champaign, IL 61820

BSTRACT. Studies of three groups of North American Acalypha (Eu-
Peientie ni species are presented. Acalypha hederacea and A. monostachya
have traditionally been separated by plant sexuality and staminate inflores-

hederacea should be treated as a synonym of A. monostachya. Acalypha
lindheimeri and A. phleoides supposedly differ in toothing of the bracts sub-
tending the pistillate flowers and in the shape of the leaf apices. However
bract toothing is highly variable among these plants and leaf apex shape
varies Clinally, with numerous intermediates. Acalypha lindheimeri, based on
specimens both geographically and morphologically extreme, should be treat-
ed as a synonym of A. phleoides. The A. virginica group has a complex
taxonomic history. Taxonomic confusion has resulted from emphasis on wer
acters that are unreliable because they show overlapping variation

taxa. Five species can be distinguished based on unambiguous, otha ei
ping characters.

Key Words: Acalypha, A. monostachya, A. phleoides, A. virginica, Euphor-
biaceae

In the course of my studies of Acalypha (Euphorbiaceae) for
Flora of North America (Levin, in press), I have had to address
several taxonomic problems in this large genus. Here I present
the sie of those investigations in more detail. There has not
been a comprehensive study of the North American species of
pevarthites published since Pax and Hoffman (1924) reviewed the
entire genus. However, Miller (1964) studied the native species
with varying depth and McVaugh (1961) studied two of the spe-
cies that have distributions extending south into Mexico. In ad-
dition, the A. virginica group has received considerable attention
(Cooperrider 1984; Reveal et al. 1990; Weatherby 1927, 1937,
1940).

ACALYPHA MONOSTACHYA CAV. AND A. HEDERACEA TORR.

Acalypha hederacea and A. monostachya have generally been
distinguished by the length of the staminate spikes (Miiller 1866;

217

218 Rhodora [Vol. 101

Pax and Hoffmann 1924), with those of A. hederacea said to be
about 6 cm long vs. 2—3 cm in A. monostachya. Plants assigned
to both species are widespread in Mexico, but those in the United
States have generally been called A. hederacea. McVaugh (1961)
argued that the spikes of specimens generally called A. hederacea
were rarely longer than 3 cm and often less than 2 cm, and there-
fore proposed that the taxa were not distinct. In contrast, Miller
(1964) stated that the staminate spikes of A. hederacea averaged
about 3.5 cm based on both measurements across the geographic
range of the species and a population sample (presumably from
Texas). Elsewhere Miller (1970) gave the length as 16-84 mm.
She nowhere gave lengths for A. monostachya. Miller (1964) also
argued that A. hederacea is mostly dioecious and generally has
both terminal and axillary pistillate spikes, and implied that A.
monostachya is monoecious and has strictly axillary pistillate
spikes (both species, according to Miller and all other authors,
have exclusively terminal staminate spikes). In the only other
source of original observations, Johnston and Warnock (1962)
studied A. hederacea. They gave the length of the staminate
“thyrses”—presumably meaning the fertile portion of the inflo-
rescence because they said the thyrses are peduncled—as ‘‘1—3
(—6) cm” and stated that the plants were usually monoecious.
None of these authors studied type material of A. monostachya,
although both McVaugh (1961) and Miller (1964) discussed Ca-
vanilles’ (1800) illustration of this species. Miller (1964) appar-
ently examined four of the seven syntypes of A. hederacea, but
there is no indication McVaugh (1961) or Johnston and Warnock
(1962) studied any of the type material.

Sexuality. I studied about 250 specimens from throughout
the range of this complex from GH, LL, MICH, MO, NY, and TEX
(herbarium abbreviations follow Holmgren et al. 1990). I ob-
served three types of plants: pistillate flowers only, staminate
flowers only, and monoecious (those with both staminate and pis-
tillate flowers). Pistillate plants bore both axillary and terminal
spikes, whereas staminate plants bore strictly terminal, long-pe-
dunculate spikes. Inflorescence distribution on the monoecious
plants was more complicated. Staminate flowers were always pro-
duced in terminal spikes. These were sometimes unisexual, but
more often androgynous with one to three pistillate flowers near
the base of the peduncle. On most monoecious plants the pistillate

1999] Levin—Acalypha in North America 219

spikes were all axillary, but some monoecious plants also bore
terminal pistillate spikes.

I was able to locate five of the seven syntypes of Acalypha
hederacea. Four of these (Bigelow s.n., Edwards & Eaton s.n.,
Wright 648, 1814) consist of unisexual plants, whereas Wright
1813, from Texas, is monoecious, with axillary pistillate spikes
and terminal androgynous spikes bearing a single pistillate flower
near the base of the peduncle of the otherwise staminate spikes.
The type of A. monostachya was not designated, but apparently
is Née s.n. (MA), the specimen itself from a plant cultivated at
Madrid (R. McVaugh, pers. comm.). I haven’t seen this specimen,
but presumably it was the model for Cavanilles’ (1800) illustra-
tion, which shows a monoecious plant with axillary pistillate in-
florescences.

It is difficult to assess the sexuality of populations from her-
barium specimens, because most collections consist of just a sin-
gle plant. However it is still clear that within the Acalypha hea-
eracea/monostachya complex, sexuality varies geographically. In
the northern part of the range, both unisexual and monoecious
plants are common, and from collections it appears that popula-
tions may consist of unisexual plants or may be mixed monoe-
cious and pistillate. In only one case, Marsh 3111 (TEx), from
Coahuila, did I observe both staminate and monoecious plants in
a single collection; this collection also included pistillate plants.
Farther south, monoecious plants predominate and unisexual
plants are almost absent. For example, of 55 specimens I ob-
served from the Mexican states of Aguascalientes, Durango, Gu-
anajuato, Hidalgo, Oaxaca, Puebla, Queretaro, San Luis Potosi,
and Zacatecas, 51 were monoecious, two (one each from Guana-
juato and Hidalgo) were pistillate, and two (one each from Dur-
ango and Hidalgo) were staminate.

To quantify this variation, I used the proportion of monoecious
plants among all plants bearing staminate flowers, i.e., the sum
of staminate plus monoecious plants. I used this statistic for two
reasons. First, pistillate plants are likely to be over-represented in
collections because the pistillate spikes persist longer than the
staminate spikes. Second, as I discussed before, populations with
monoecious plants may also contain pistillate plants, especially
in the northern part of the range of the complex. Measured this
way, Texas had the lowest frequency of monoecious plants, 56%.
The northern tier of Mexican states (Chihuahua, Coahuila, Dur-

220 Rhodora [Vol. 101

ango, Nuevo Leén, and Tamaulipas) had a higher rate of 80%,
and the remaining eight Mexican states within the range had an
overall rate of 98%, with many having no staminate plants at all.
Although the frequency of monoecious plants clearly increases
southwards (x? test using the three geographic areas, P < 0.0001),
monoecious plants are common throughout the range of the com-

ex.

As might be expected because of the geographic pattern in
sexuality and the historical identification of northern plants as
Acalypha hederacea and southern plants as A. monostachya, there
is a strong association between determination and sexuality (x?
test, P < 0.0001). About 68% of sampled plants historically de-
termined as A. hederacea were monoecious, whereas 96% of A.
monostachya were monoecious. Clearly, though, monoecy is
common, even among plants that have been called A. hederacea.
This result is consistent with McVaugh (1961) and Johnston and
Warnock (1962), but not with Miller (1964, 1970).

Staminate spike length. I measured the staminate or an-
drogynous spike length on the 191 specimens containing mature
staminate or monoecious plants. Of these, 50 were determined as
Acalypha hederacea and 141 as A. monostachya. The staminate
and androgynous spikes consist of two portions, the peduncle and
the fertile staminate portion, which I measured separately. To ex-
plore geographic variation, I divided the range into three regions,
Texas, northern Mexico (Chihuahua, Coahuila, Durango, Nuevo
Leén, and Tamaulipas), and central/southern Mexico (Aguascal-
ientes, Guanajuato, Hidalgo, Oaxaca, Puebla, San Luis Potosi,
and Zacatecas), and randomly sampled 48 specimens from each
(48 was chosen because that was the number of specimens avail-
able from the third region). Peduncle length, staminate portion
length, and total spike length did not significantly differ among
the three areas (Table 1).

I also tested for differences between monoecious and staminate
plants, and between plants historically determined as A. hedera-
cea and A. monostachya, using all 191 specimens. Lengths of the
peduncle, staminate portion, and total spike did not significantly
differ by plant sexuality (Table 2A) or by historical determination
(Table 2B). Among all the specimens, the length of the fertile
portion of the staminate spike was 1-4 cm (mean = 2.1 cm) and
the total length of the spike was 1.9-7.9 cm (mean = 4.0 cm).

Table 1. Regional variation in staminate and androgynous inflorescence dimensions that have been used to distinguish Acalypha
hederacea and A, monostachya. Regions are A: Texas, B: northern Mexico (Chihuahua, Coahuila, Durango, Nuevo Leon, and
Tamaulipas), and C: central and southern Mexico (Aguascalientes, Guanajuato, Hidalgo, Oaxaca, Puebla, Queretaro, San Luis Potosi,
and Zacatecas). Lengths are shown as mean + standard error based on 48 herbarium specimens from each region. Probabilities are
for the given F values obtained by one-way analysis of variance.

Region
A B Cc F P
Peduncle length — 1.84 + 0.073 1.98 + 0.084 2.03 + 0.103 1.305 0.274
Staminate portion length (cm) 2.08 + 0.083 2.10 + 0.084 2.22 + 0.096 0.745 0.477
Total wpe dapat aut (cm) 3.92 + 0.140 4.04 + 0.153 4.25 = 0.177 1.134 0.325

ROLIDUTY YON ul pydd<jppoy—utagy]

77> Rhodora [Vol. 101

Table 2. Comparison of staminate and androgynous inflorescence dimen-
sions that have been used to distinguish Acalypha hederacea and A. mono-

vs. A. monostachya). Lengths are shown as mean + standard error. Proba-
bilities are based on two-tailed f-tests assuming unequal sample variances.

A. Plant Sexuality

Unisexual Plants Monoecious
(n = 47) (n = 144)

Peduncle length (cm) 1.85 + 0.065 1.95 + 0.051 £17627: 03242
i rtion
length (cm) 2.06 + 0.085 2.14 + 0.053 0.845 0.400
Total inflorescence
ngth (cm)

3.91. 0.133. 4.10 + 0.093 P1222 O265
B. Original Determination
A. hederacea A. monostachya
(n= 14 (n = 50)
Peduncle length (cm) 1.89 + 0.046 2.04 + 0.092 1522-03132
Staminate portion

length (cm) 212-* 0/052 2.14 + 0.093 0.235 0.815
Total inflorescence
length (cm) 4.00 + 0.088 4.18 + 0.163 0.979 0.330

These results do not support the use of staminate spike length
to distinguish Acalypha hederacea and A. monostachya. It is pos-
sible that the complex has two species, differing in sexuality, with
broadly overlapping geographic ranges. However, I found no oth-
er morphological features that differentiate two groups. I suspect
that Miller (1964) studied relatively few specimens (she gave no
sample size) and that she measured the entire staminate spike,
whereas McVaugh (1961) measured only the fertile staminate
portion, hence the differences in their observations. When inter-
preted this way, their measurements are consistent with mine.
Because I can find no way to distinguish two s cies, I agree
with McVaugh (1961) that only a single species is involved,
which should be called A. monostachya.

ACALYPHA PHLEOIDES CAV. AND A. LINDHEIMERI MULL. ARG.

Acalypha phleoides is traditionally interpreted as a species of
the arid highlands of eastern and central Mexico, ranging as far

1999] Levin—Acalypha in North America 223

north as Chihuahua and Coahuila. Overlapping with this in north-
ern Mexico and extending into Arizona, New Mexico, and Texas,
is what is usually called A. lindheimeri. According to Miiller
(1866), A. lindheimeri has acuminate rather than acute leaves, the
terminal tooth of the bracts subtending the pistillate flowers pro-
longed rather than equal to the other teeth, and more slender style
branches.

I examined more than 400 specimens from throughout the
range of these two taxa. Leaves on plants from Texas are mostly
rhombic-ovate and acuminate, though lower leaves tend to be
broader relative to their length and have acute apices. Sometimes
the bracts subtending the pistillate flowers have elongate terminal
teeth, as they do on two of the isosyntypes of Acalypha lindhei-
meri I have seen (Lindheimer 520 [CAN!, GH!, MO!] and Lindhei-
mer 688 [GH!, MO!]), but more often all the teeth are subequal,

s they are on the third isosyntype I examined (Wright 1815
[GH!]). Leaves of plants from central Mexico south are ovate to
suborbicular (especially the lower leaves) with consistently acute
apices. The teeth of the bracts subtending the pistillate flowers
are consistently subequal. There is also a tendency for the more
southerly plants to have denser and coarser pubescence than the
more northerly plants, especially those from Texas. Plants from
Arizona, e.g., Blumer 1498 (ARIZ!, GH!, ISC!, NMC!; the type of A.
lindheimeri var. major Pax & K. Hoffm.), and northern Mexico
are intermediate between the Texan and central Mexican plants,
with no obvious discontinuities. I could distinguish no differences
in style branch thickness. The difficulty of quantifying leaf shape
and its variation within individual plants makes statistic analysis
extremely problematic. However, because leaf shape varies ap-
parently continuously throughout the range of the group and bract
toothing shows no consistent pattern, it appears that A. lindhei-
meri was based on a few extreme specimens of A. phleoides. It
therefore seems preferable to treat all these plants as a single
species using the older name, A. phleoides.

ACALYPHA VIRGINICA GROUP

The Acalypha virginica group has received the greatest study
of any North American members of the genus. Through much of
the 18" and 19" centuries, there was considerable disagreement
in interpretation of this group, but most authors recognized either

224 Rhodora [Vol. 101

one or two taxa. Miiller (1865, 1866), however, recognized four
taxa in the group, all as varieties of A. virginica. In a series of
papers, Weatherby (1927, 1937, 1940) attempted to sort out the
variation in the group and to resolve a nagging typification prob-
lem surrounding the name A. virginica. Ultimately he recognized
three species, A. gracilens A. Gray with three varieties [var. gra-
cilens, var. fraseri (Mill. Arg.) Weath., and var. monococca En-
gelm. ex A. Gray], A. rhomboidea Raf. with two varieties [var.
rhomboidea and the newly described var. deamii (Weath.)
Weath.], and A. virginica. Unfortunately, the typification problem
was not finally resolved until 1990 (Reveal et al. 1990), when
conservation of the name and type of A. virginica established
Weatherby’s (1937) treatment.

Weatherby’s treatment (1937) continues to be widely used to-
day. However, two additional treatments have also had some in-
fluence. First, Miller (1964, 1969, 1970; Gandhi and Hatch 1988)
recognized five species in the group, Acalypha deamii (Weath.)
H. E. Ahles, A. gracilens, A. monococca (Engelm. ex A. Gray)
Lill. W. Miller & Gandhi, A. rhomboidea, and A. virginica. In
addition to segregating A. monococca as a separate species, she
further realigned A. gracilens by treating var. fraseri as a syno-
nym of A. gracilens var. gracilens and recognizing A. gracilens
var. delzii Lill. W. Miller. The second treatment was by Cooper-
rider (1984, 1995). Studying almost exclusively plants from Ohio
and therefore not considering A. gracilens or A. monococca, he
treated the remaining three taxa as varieties of A. virginica [thus
A. virginica var. deamii Weath., A. virginica var. rhomboidea
(Raf.) Cooperr., and A. virginica var. virginica].

In justifying his treatment, Cooperrider (1984) stated that he
saw many intermediates between his varieties of Acalypha vir-
ginica, particularly between var. rhomboidea and var. virginica,
and further that “‘no single reliable diagnostic character or com-
bination of characters’’ separates these taxa. Based on my obser-
vations, I disagree. Instead, the apparent intergradation and lack
of diagnostic characters reflect two problems. First, most of the
characters used by Weatherby (1927, 1937) and Miller (1964,
1970) are not always reliable. Second, and clearly related to the
first, misidentifications are rife in herbaria. On the approximately

4,000 specimens of A. rhomboidea and A. virginica I examined,
about 18% of the annotations applied since 1940 (sufficiently
after Weatherby’s publications to allow them to become widely

1999] Levin—Acalypha in North America phe

used) were misidentified, about half of these bearing names of
the other taxon. (In this calculation I excluded Miller’s annota-
tions, with which I almost entirely concur.) Cooperrider’s own
identifications are instructive. I have seen 96 specimens of the
two species he annotated. We agree on almost all that he called
A. virginica var. rhomboidea, but we would agree on only 44%
(eight of 18) that he called A. virginica var. virginica. Perhaps
this high frequency of misidentifications prevented him from see-
ing the clear and reliable distinctions between these taxa. I found
a similar rate of misidentifications among specimens of A. gra-
cilens and A. virginica. (Another consequence of the high rate of
misidentifications is that most published range maps are not re-
liable.)

Most regional floras that treat several taxa in the Acalypha
virginica group (e.g., Cooperrider 1995; Gleason and Cronquist
1991; Miller 1970; Mohlenbrock 1982, 1986; Radford et al. 1968;
Steyermark 1963) distinguish them using some combination of
stem pubescence (long spreading and short incurved vs. just short
incurved), petiole length (either absolute or relative to leaf
length), leaf shape, shape and number of teeth or lobes on the
bracts subtending the pistillate flowers, pubescence on these
bracts, carpel number, and seed size. Table 3 summarizes these
characteristics for the five species recognized by Miller (1964,
1970) and me. Some of these characters are unambiguous and
serve to distinguish individual taxa. For example, A. virginica is
unique in having long spreading eglandular trichomes on the ab-
axial surface of the pistillate bracts, and mature plants always
bear these (the lowermost bracts on the plant may lack the spread-
ing hairs, however). Similarly, A. deamii always has gynoecia
with two carpels and A. monococca has gynoecia with one carpel,
whereas the remaining species have three carpels. Also A. deamii
has seeds that are at least 2.2 mm long, whereas the other species
have seeds no more than 2.0 mm long, with the exception of A.
monococca, which occasionally has seeds to 2.4 mm long. Out-
group comparison with A. alopecuroides Jacq., A. arvensis
Poepp., A. australis L., A. brachystachya Hornem., A. indica L.,
and A. mexicana Miill. Arg. suggests that these unique charac-
teristics are all apomorphies of the individual species (Table 3).

Other characters may be useful in separating otherwise similar
species. A sample of 100 specimens each of Acalypha virginica
and A. rhomboidea showed that the number of lobes on the pis-

Table 3. Summary of characters often used to separate species in the Acalypha virginica group, compiled from herbarium
specimens from throughout the geographic ranges of the species. Values for quantitative characters are ranges. Sample sizes are n
= 100 except for A. deamii, a rare species for which n = 35. Asterisks (*) indicate unambiguous unique species-level apomorphies
based on outgroup comparison with A. alopecuroides, A. arvensis, A. australis, A. brachystachya, A. indica, and A. mexicana.

A. mono-
Character A. deamii_ A. gracilens cocca A. rhomboidea A. virginica

Stems with long spreading hairs Never Never Never About 5% of plants About 90% of plants
Petiole length (cm) 2.5-7.0 0.2-1.4 0.2-0.9 0.8-7.0 0.7-3.6
Petiole length/leaf blade length 0.42-0.94 0.09-0.30 0.08-0.20 0.34—0.89 0.23—0.66
Leaf blade length/width 1.5—2.0 2.3-8.0 2.8-8.7 1.4-3.2 2.1-4.5
Pistillate bracts with long spreading No No No No Yes (except sometimes

eglandular hairs the lowermost on the

plant)*

Pistillate bracts with red glands No Yes Yes No No
Pistillate bract tooth (lobe) length

(mm 4.5-9.0 0.6—2.2 0.9-2.2 1.8-9.0 1.6—5.0
Pistillate bract tooth (lobe) length/pis-

tillate bract length 0.44-0.75 0.08-0.28 0.10-0.25 0.30-0.75 0.21-0.50
Number of teeth/lobes on pistillate

bracts (average of 3—S bracts) 5.38.0 9.0-13.3 9.0-13.7 5.7-8.7 10.0-—13.7
Carpel number . 1% 3
Seed length (mm) 2.2-3.1* 1.1-1.9 1.62.4 1.3-2.0 1.3-1.8

9C7

elopoyuy

TOI T°A]

1999] Levin—Acalypha in North America 227

tillate bracts is a reliable character distinguishing these species.
It is true that individual bracts of A. rhomboidea may have as
many as nine lobes and bracts of A. virginica may have as few
as nine lobes. However, averaging three to five bracts per plant
gave no more than 8.7 lobes/bract for A. rhomboidea and no
fewer than 10 lobes/bract for A. virginica (Table 3; Figure 1). The
presence of red glands on the pistillate bracts, at least on the tooth
apices and often scattered on the abaxial surface, distinguishes A.
gracilens from very young plants of A. virginica that have not
yet produced bracts with spreading trichomes. (Acalypha mono-
cocca also produces these red glands.) A particularly interesting
situation that has not been noted previously is that scattered
throughout the range of A. rhomboidea, but more frequent in the
southern states, are small plants with short petioles, small leaves,
and small pistillate bracts with short teeth. These often appear in
herbaria labeled A. gracilens, presumably because of the short
petioles and bract teeth. However, tooth number is consistently
nine or fewer, the petioles are at least 40% the length of the leaf
blades, the bract teeth are more than 30% the length of the bracts,
and the bracts do not bear red glands. These characteristics clearly
demonstrate that these plants are simply small A. rhomboidea
rather than A. gracilens (Table 3; Figure 1)

Some characteristics that are frequently used to distinguish spe-
cies in the Acalypha virginica group are not consistent and over-
lap among species. Notably, these include leaf shape (described
by blade length/width; all species in this group have the same
general shape, so this ratio is an appropriate statistic) and both
absolute and relative petiole lengths (Table 3; Figure 1). Although
very different species may show no overlap, others, like A. rhom-
boidea and A. bene show no reliable differences in these
characters. Neither is the presence or absence of spreading tri-
chomes on the =o reliable. Nearly 10% of the A. virginica
specimens I sampled lacked spreading trichomes, whereas 5% of

. rhomboidea specimens eae bore them. Spreading stem
trichomes are absent on the remaining species. It is likely that
use of these unreliable ie acd has contributed to the rel-
atively frequent misidentifications and the taxonomic confusion
in this group.

The data summarized in Table 3 demonstrate that, in fact, in-
termediates among the taxa in the Acalypha virginica group are
exceedingly rare or absent. The taxa are often found growing

228

Petiole length/leaf length

Rhodora

[Vol. 101

1.0-
0.8

0.6

0.4+

Number of carpellate bract lobes

1
2 4 6 8 10
Leaf length/width

4 | | |
0.0 0.2 0.4 0.6 0.8
Carpellate bract lobe length/bract length

1999] Levin—Acalypha in North America 229

nearby or together, notably A. deamii with A. rhomboidea; A.
gracilens with A. monococca, A. rhomboidea, or A. virginica; A.
monococca with A. virginica; and, most frequently, A. rhomboi-
dea with A. virginica (pers. obs.). Yet examination of over 6500
specimens revealed no clear evidence for hybridization, nor have
I found evidence for hybridization during field work throughout
much of the range of these taxa.

The presence of unique apomorphies (Table 3) for Acalypha
deamii (two carpels/flower, seeds at least 2.2 mm long), A. mon-
ococca (one carpel/flower), and A. virginica (long spreading
eglandular trichomes on the abaxial surface of the pistillate
bracts), supports recognition of these taxa as species under both
the phylogenetic (Davis and Nixon 1992; Nixon and Wheeler
1990) and genealogical (Baum and Donoghue 1995; de Queiroz
and Donoghue 1988; Olmstead 1995) species concepts. Because
they are distinguishable by nonoverlapping characters, A. graci-
lens and A. rhomboidea would also be species under the phylo-
genetic species concept, but because they lack unique apomor-
phies (insofar as known), they would be metaspecies under the
genealogical species concept. In either case, under both of these
cladistically based species concepts, all the taxa in the A. virgin-
ica group should be recognized at the rank of species. I do not
recognize any infraspecific taxa in A. gracilens because variation
in this species is clinal over broad geographic areas (Levin 1998).

Key to the species of the Acalypha virginica group. I also
include in the key the introduced Acalypha australis, which may
be confused with members of this group.

1. Leaf blades linear to oblong-lanceolate; petioles rarely more
than /, the length of the leaf blades; bracts of pistillate
flowers with deltoid teeth Y,,—Y, length of the bract, with
sparse to dense sessile red glands ................ (2)

Figure 1. Plots showing the variation in the sie legigil virginica group
along four characters. All species are represented by n 100 except A.
deamii, a rare species with n = 35. Note that both axes in the upper graph
are logarithmic. Key to symbols: A. deamii O, A. gracilens (1, A. monococca
©, A. rhomboidea A, and A. virginica ¥*.

230 Rhodora [Vol. 101

2. Pistil with 3 carpels, usually producing 3 seeds .....
es AG pees. A. woes oanu calypha gracilens

2. Pistil with 1 carpel, producing 1 seed ..............
pad ONES 4 Hal RS EE Acalypha monococca
1. Leaf blades broadly lanceolate to ovate; petioles more than Y,
(usually more than /,) the length of the leaf blades; bracts
of pistillate flowers either with triangular to lanceolate
lobes more than Y, the length of the bract or with rounded
teeth less than ¥,, the length of the bract, lacking red
ROUEN SW 2K JUG OTE OS. auth 6a (3)
3. Bracts of pistillate flowers hirsute with dense long
spreading non-glandular hairs (also ciliate and often
with stalked glands), and with (9—) 10-14 (-16)
lobes more than Y, the length of the bract; stems

usually hirsute with long spreading hairs .....
tcc gap nA, © bees oie Ae att ek Weer calypha virginica
3. Bracts of pistillate flowers without long spreading non-
glandular hairs (may be ciliate or with stalked
glands), and with either (S—) 7-9 (-11) lobes more
than ¥, the length of the bract or 12-15 teeth less
than “9 the length of the bract; stems very rarely

u (
4. Bracts of pistillate flowers with 12-15 rounded teeth
less than '/,) the length of the bract .......
eee ed Ce Oke Feo als Acalypha australis
4. Bracts of pistillate flowers with (5—) 7-9 (-11) lan-
ceolate lobes more than ¥, the length of the bract

(

5. Pistils with 3 carpels; seeds <2.1 mm We ss
(eee owebaimlio Acalypha rhomboidea
5. Pistils with 2 carpels; seeds >2.1 mm long .....
aaa 5 tn'etcaly ghee SDL SDS | E Acalypha deamii

Taxonomic treatment of the Acalypha virginica group.

1. Acalypha deamii (Weath.) H. E. Ahles in Jones & Fuller, Vasc.
Pl. Illinois 301. 1955.

Bitsieats i hip L. var. deamii Weath., Rhodora 29: 197. 1927. TyPE:
NITED STATES. Indiana: Dearborn Co., road along White Water
Be Py mi. northeast of Logan, Oct 20, 1924. C.C. Deam 41107

1999] Levin—Acalypha in North America 231

(HOLOTYPE: IND!; ISOTYPE: GH!). Acalypha rhomboidea Raf. var.
deamii (Weath.) Weath., Rhodora 39: 16. 1937

2. Acalypha gracilens A. Gray, Manual 408. 1848. Type: UNITED
STATES. Virginia. F.J.X. Rugel s.n. (LECTOTYPE—designated
by G. A. Levin, Syst. Bot. 23:285. 1998[1999]: GH!; ISOLEC-
TOTYPE: G). Acalypha virginica L. var. gracilens (A. Gray)
Miill. Arg., Linnaea 34: 45. 1865
Acalypha = L. var. fraseri Miill. Arg., Linnaea 34: 45. 1865.

D STATES. South Carolina. J. Fraser s.n. (HOLOTYPE: G-
Dc, microfiche!). Acalypha gracilens A. Gray var. fraseri (Miill.
Arg.) Weath., Rhodora 29: 202. 1927.
whist earn A. Gray var. delzii Lill. W. Miller, Sida 3: 447. 1969.
Bahia STATES. Arkansas: Hot Spring Co., Bismarck PO., Jul
“i "1957 oD: Bonded 39432 (HOLOTYPE: SMU!; ISOTYPES: GH!,
KANU!, OKL!).

3. Acalypha monococca (Engelm. ex A. Gray) Lill. W. Miller &
Gandhi, Sida 13: 123. 1988.

Acalypha gracilens A. Gray var. monococca Engelm. ex A. Gray, Man-

2, 390. 1856. TYPE: UNITED STATES. Missouri: St. Louis

Co., limestone precipices on the banks of the Mississippi River

ISOTYPE: WIS!). Acalypha gracilens A. Gray ssp. monococca (En-
gelm. ex A. Gray) G. L. Webster, J. Arnold Arbor. 48: 373. 1967.

4. Acalypha rhomboidea Raf., New FI. 1: 45. 1836. Type: UNIT-
ED STATES. South Carolina. C.S. Rafinesque s.n. (LECTOTYPE—
designated by C. A. Weatherby, Rhodera 42: 96. 1940: G-
DEL, photo at GH!). Acalypha virginica L. var. genuina Miill.

g., Linnaea 34: 44. 1865. Acalypha virginica L. var. rhom-
boidea (Raf.) Cooperr., Michigan Bot. 23: 165. 1984.

5. Acalypha virginica L., Sp. P1. 1003. 1753. Type (conserved):
UNITED STATES. Virginia. J. Clayton 20] (HOLOTYPE: BM,
drawing at GH!). Acalypha virginica L. var. intermedia Miill.
Arg., Linnaea 34: 45. 1865.

Acalypha digyneia Raf., Fl. Ludov. 112. 1817. Type: none located.

ACKNOWLEDGMENTS. ‘This research was supported by a grant
from the Campus Research Board of the University of Illinois,
Urbana-Champaign. I thank the curators and staff of the following
herbaria for allowing me to study the specimens in their care: A,
ARIZ, ASU, BKL, BM, BRIT, BUT, CAN, CAS, CHRB, CLEMS, CM, DAO,

Za2 Rhodora [Vol. 101

DAV, DES, DHL, DS, EIU, F, FARM, FLAS, FSU, FTG, GA, GH, GMUF, IA,
ILLS, IND, ISC, KANU, KE, LL, LSU, LYN, MARY, MICH, MIN, MO, MT,
MU, NCU, ND, NEB, NEBC, NMC, NY, NYS, OKL, OKLA, OS, PAUH, PENN,

NM,
Rick Phillippe, “hin Hill, Tom Mione, and two anonymous re-
viewers provided helpful comments on earlier versions of the
manuscript.

LITERATURE CITED

Baum, D. A. AND M. - DONOGHUE. 1995. Choosing among alternative “‘phy-
logenetic sel concepts. Syst. Bot. 20: 560-573.

CavANILLES, A. J. 1800. Descripcion del genero Bonplandia, y de otras plan-
tas. Anales Hist. Nat. Madrid 2: 12-142.

COoPERRIDER, T. S. 1984. Some ers mergers and new combinations in the
Ohio flora. Michigan Bot. 23: —168.

. 1995. The Dicotyledoneae : Ohio. Part 2. Linaceae Through Cam-

panulacese. a State Univ. Press, Columbus, OH.

Davis, J. I. AND K. C. Nixon. 1992. Populations, genetic variation, and the
ie of ei sioner species. Syst. Biol. 41: 421-435.

DE QUE K. AND NOGHUE. 1988. Phylogenetic systematics and
ta ein problem Cladisis 4: 317-338.

GANDHI, K. N. AND S. L. H 1988. Nomenclatural aceite in Acalypha
utiles or fae aon (Fabaceae). Sida 13: 122-123.

GLEASON, H. AND A. CRONQUIST. 1991. Manual of Vascular Plants of
Northeastern United States and Adjacent Canada. The New York Botan-
ical Garden, Bronx, NY.

Hotmcren, P. K., N. H. HOLMGREN, AND L. C. BARNETT, eds. 1990. Index
Herbariorum. Part I: The Herbaria of the World, 8th ed. The New York

tanical oo Sapa NY.

JOHNSTON, M. C. A - H. Warnock. 1962. The four species of a
peter in niet western Texas. SouthW. Naturalist 7: 182-190.

Levin, G. A. 1998 [1999]. Evolution in the Ac. alypha gracilens/monococca
complex (Euphorbiaceae): Morphological analysis. Syst. Bot. 23: 269-—
288.

———. In press. Acalypha pr spe sng In: Flora of North America
Editorial Committee, eds. 1993+. Flora of North America North of Mex-
ico, Vol. 12. Oxford Univ. Press, New York and Oxford.

McVauau, R. 1961. ea amernan novae Novo-Galicianae. Brittonia 13:
145-205.

, L. W. 1964. A taxonomic treatment of the species of Acalypha in the
United States. Ph.D. dissertation, Purdue Uni niversity, West Lafayette, IN.
. 1969. Acalypha gracilens uy var. delzii L. Miller, var. nov. Sida

a
: 1970. Acalypha, pp. 943-947. In: D. S. Correll and M. C. Johnston,

1999] Levin—Acalypha in North America 233

eds., Manual of the Vascular Plants of Texas. Texas Research Founda-
tion, Renner,
MOHLENBROCK, R. H. 1982. psieae Plants: Basswoods to Spurges. South-
ois Univ. Press, Car ey Us.
. 1986. Guide to the Veal: Flora of Illinois, revised and enlarged
ed. Southern Illinois Univ. Press, Carbondale, IL.
MULLER, J. 1865. Vorlaiifige Mitteilungen aus dem fiir De Candolle’s Prod-
i i 26.

ten Manu :

. 1866. Euphorbiaceae, pp. 189-1286. In: A. De Candolle, ed., Prod-
romus Systematis Naturalis Regni Vegetabilis, Vol. 15(2). Victor Mas-
son, Paris.

Nixon, K. C. AND Q. D. WHEELER. 1990. An amplification of the phylogenetic
species concept. Cladistics 6: 211-223.

OLmsTEAD, R. G. 1995. Species concepts and plesiomorphic species. Syst.

Pax, F AND K. HOFFMANN. 1924. VE oe fea ha ce ee ae—
Acalyphinae, Additamentum VII, 1-231. In: A. Engler, ed., Das
Pflanzenreich, IV, 147. XVI (Heft 5).
RADFORD, A. E., H. A. AHLES, AND C. R. BELL. 1968. Manual of the Vascular
Flora of the Carolinas. Univ. of North Carolina Press, Chapel Hill, NC.
REVEAL, J. L., C. E. JARvis, AND FR. Barrie. 1990. Proposal to conserve
the name and type of Acalypha virginica L. (Euphorbiaceae). Taxon 39:
361-363.
TEYERMARK, J. A. 1963. Flora of Missouri. Iowa State Univ. Press, Ames, IA.
baa weer C. A. 1927. The group of Acalypha virginica in eastern North
ca. Rhodora 29: 193-204.
: 1937, The typification of Acalypha virginica L. Rhodora 39: 14-16.
- 1940. Rafinesque types in the group of Acalypha virginica. Rhodora
2:96.

RHODORA, Vol. 101, No. 907, pp. 234-263, 1999

THE F TER SPECIES OF VAUCHERIA
(TRIBOPHYCEAE, CHRYSOPHYTA)
FROM CTICUT

CRAIG W. SCHNEIDER, CHRISTOPHER E. LANE, AND
ANNA NORLAND!
Department of Biology, Trinity College, Hartford, CT 06106-3100

ABSTRACT. Having scoured freshwater habitats throughout Connecticut for
more than two years at 151 collection sites, we have discovered the presence
of nine species and two varieties of the genus Vaucheria, including four
species not Fe known from the state: V. prona, V. taylorii, V. uncin-

ata, and ndulata. In addition, V. compacta, normally found in local es-
tuaries, is fara in freshwater here, and is distinguished from its local
freshwater variety, V. compacta var. dulcis. Culture conditions in the labo-
ratory stimulated production of gametangia, allowing for identification of
mostly vegetative a tic ca samples. A key to the species and varieties
is provide

Key Words: Vaucheria, Vaucheriaceae, Tribophyceae, Connecticut

Vaucheria is a yellow-green alga commonly encountered along
freshwater stream and river banks, in mud surrounding small
ponds and marshes, in drainage ditches alongside roadways, and
in puddles and vernal pools worldwide. In habitats such as these,
coenocytic siphons of Vaucheria act as ecologically important
substratum stabilizers, often during continual environmental dis-
ruption. Although most species in the genus live in freshwater,
several species are found in brackish water, and a few are com-
pletely restricted to marine environments (Blum 1972). Vaucheria
species have been shown to be euryhaline, often tolerating great
variation in salinity in very short periods of time (Schneider et
al. 1993).

The first recorded collections of freshwater Vaucheria from
Connecticut were included in the early and important North
merican exsiccata, Phycotheca Boreali-Americana (P.B.-A.,
Collins et al. 1895, 1898, 1905). This exsiccata included three
freshwater Vaucheria specimens from the state: V. terrestris
Lyngb. [= V. frigida (Roth) C. Agardh], Fasc. II (1895), no. 78a

' Current address: Harvard University Graduate School of Education, Ap-
pian Way, Cambridge, MA 02138.

234

1999] Schneider et al—Vaucheria from Connecticut 235

(Setchell, 9.x.1892, Norwich); V. aversa Hassall, Fasc. X (1898),
no. 475 (Holden, 3.xiii.1892, Mill R.., Fairfield); and V. geminata
(Vaucher) DC with some V. geminata var. racemosa (Vaucher)

alz [= V. racemosa (Vaucher) DC], Fasc. XXVI (1905), no.
1287, (Holden, 9.iv.1892, Ash Creek, Bridgeport). In his mono-
graphic treatment of freshwater and marine “green” algae from
North America, Collins (1909) included only five freshwater spe-
cies of Vaucheria for all of North America, reflecting the limited
knowledge of the genus at that time. Of these, only V. aversa and
V. sessilis (Vaucher) DC [= V. bursata (O. FE Miill.) C. Agardh]
were reported from Connecticut. Conn and Webster (1908) pub-
lished the first report on freshwater algae specifically from the
state, and recorded only one species, V. bursata (as V. sessilis).
Hylander (1925, 1928) included five freshwater species of Vauch-
eria in his “Algae of Connecticut,”’ based on limited reports from
throughout the state. These included V. aversa from Fairfield; V.
bursata (as V. sessilis) from Brookfield and Middletown; V. fri-
gida (as V. terrestris) from Litchfield, Hartford, New Haven, and
New London counties; V. geminata from Bridgeport, Barkham-
sted, and New Haven; and V. racemosa (as V. geminata vat. ra-
cemosa) from New Haven (Hylander, 1925). Each of these spe-
cies was then recorded in the first monograph of Vaucheria for
North America by Helen Brown (1929). John Blum’s (1972) later
seminal monograph on the ‘‘Family Vaucheriaceae,” published
as part of the New York Botanical Garden’s ‘‘North American
Flora,” included 22 freshwater and 20 marine species, but none
with specific reference to the state. Since 1928, only one species
has been added to the freshwater Vaucheria flora of Connecticut,
when V. compacta var. dulcis J. Simons was found in abundant
populations near the junction of the Farmington and Connecticut
Rivers (Schneider et al. 1996).

Thus, in the more than a century since the first reports of
Vaucheria from Connecticut in P.B.-A., only six freshwater spe-
cies have been reported. During this time, collections were made
from only a few localities, mostly in the western part of the state,
and only a few sites were visited throughout the year. Considering
that fourteen freshwater species have been reported for New Eng-
land, New York, and New Jersey (Blum 1972), not including one
presently known only from Connecticut within that range (V.
compacta var. dulcis), the timing seemed right to conduct a basic
field and laboratory study to assess the diversity of freshwater

236 Rhodora [Vol. 101

Vaucheria in the state, and to broadly survey the local species
distributions. Only four marine/brackish species of Vaucheria
from Connecticut were recorded prior to a similar coastal study
of the genus, and five species and one variety were subsequently
added to the local flora after extensive field and culture work
(Schneider et al. 1993).

MATERIALS AND METHODS

Since the initiation of this study in 1994, we have visited 151
riparian and limnic habitats, muddy wetlands, drainage ditches,
and roadside catchments, often revisiting the same sites in dif-
ferent seasons. Crude samples were collected either as siphonous
algal mats attached to substratum, or mud itself with no obvious
signs of Vaucheria. Using a flat spatula, substrata were cut into
approximate 100 cm? quadrats, varying in thickness from 2—3 cm.
At the site, after temperature was recorded for proximal standing
water, pH (Corning pH 103 meter) and salinity were measured
(Reichert-Jung refractometer 11719-2). Field evaluation of the
substratum type (sand, mud, etc.) was made. Codes identifying
the collecting sites are given in the Appendix (bold face), and
numbers at the end of codes under ‘“‘REPRESENTATIVE COLLEC-
TIONS” represent the first, second, third, etc. visit/collection in the
same location. Collection data are followed by the first date of
gametangia appearance in culture, or noted if they were fertile in
the field collection.

The crude samples were collected in labeled, zippered, plastic
bags and transported on ice to the laboratory where they were
immediately subdivided into three labeled culture dishes. Vas-
cular plants, sticks, and leaves were removed from the surface.
Bold’s basal medium (Bischoff and Bold 1963) was added to each
culture dish to a depth of approximately one-third the thickness
of the crude sample. Samples were distributed among three pho-
toperiods (8L:16D, 12L:12D, 16L:8D) in Hotpack incubators
(#352642) set at 15°C, an optimum temperature for the growth
of Vaucheria (Schneider et al. 1993). Microscopical observations
on each crude culture were made every five to ten days. Drawings
were made with the aid of a Zeiss camera lucida, and microscope
slide vouchers (20% or 40% Karo® corn syrup, 1% aniline blue
in IN HCI in a ratio of 20:1:1) are deposited in Herbarium/C. W.
Schneider at Trinity College. The P.B.-A. set utilized in the pre-

1999] Schneider et al.—Vaucheria from Connecticut 237

sent study was originally purchased by Wellesley College (Fahey
and Doty 1955) and is presently located in the Herbarium/C. W.
Schneider. Standard forms of author names follow Brummitt aiid
Powell (1992). Because other works (e.g., Blum 1972; Entwisle
1988a) include world distributions for the species found in Con-
necticut and are often not specific for a particular place, citing
‘widespread in North America,”’ we have listed states and prov-
inces in the northeastern part of North America with known re-
ports under the designation “‘NORTHEAST DISTRIBUTION.”

RESULTS AND DISCUSSION

Few samples collected were fertile in the field. The remainder
of the collections with obvious Vaucheria siphons later produced
gametangia after 10-14 days in culture, on the average. About
30% of the mud samples never produced Vaucheria after incu-
bation in culture media. In others without obvious Vaucheria,
either siphons existed within the mud below grade, or dormant
zygotes or asexual spores were coaxed into germinating under
favorable culture/incubator conditions. Many cultures produced
two to six biotic sympatric species over time in a single crude
sample. Most species discovered in this study presented unre-
markable features from those reported for other North American
populations, so the reader is referred to Blum (1972) for full
descriptions including pertinent measurements. Where our obser-
vations have been at variance with Blum (1972), these are noted
below. We have discovered great variability in our extensive col-
lections, allowing for a greater understanding of the species and
overlap among them. Thus, when working with the polymorphic
Vaucheria, it is advisable to sample widely for species and to rely
on measurements and morphological characteristics of many in-
dividuals before making taxonomic determinations.

Although we have sampled extensively throughout the state,
we have the fewest Vaucheria species records (four) from the
northwestern Litchfield Co. This is in part due to more limited
sampling there (14 sites), but mostly because of the poor, often
sandy, substrata found in this part of the state. New records for
Connecticut are noted with asterisks (*).

238 Rhodora [Vol. 101

VAUCHERIACEAE Dumortier 1822, p. 71

Vaucheria aversa Hassal 1843, p. 429. Figures 1-3, 46.
TYPE LOCALITY: vic. Chestnut, England.
NORTHEAST DISTRIBUTION: Maine, N.H., Mass., Conn., N.Y.,
N.J.

REPRESENTATIVE COLLECTIONS: Fairfield Co.—KP1, CEL, coll. 25.x.1998,
gam. 1.xi.1998; NR2, CEL, coll. 28.xi.1997, gam. 7.ii.1998; PB1, CEL, coll.
28.xi.1997, gam. 6.i1.1998; PN1, CEL, coll. 31.v.1998, gam. 6.vi.1998; SNR1,
CEL, coll. 25.x.1998, gam. 1.xi.1998. Hartford Co.—BBB2, CWS, coll.
10.xii.1997, gam. 6.i.1998; BRWB, CWS, coll. 12.xii.1997, gam. 23.v.1998;
c fe z

gam. 3.iii.1998; GMS1, CEL/CWS, coll. 5.vi.1998, gam. 14.vi.1998;

RDD1, AN, coll. 22.ii.1998, gam. 22.iv.1998; JB1, AN, coll. 22.ii.1998,
gam. 28.v.1998; LJB1, AN, coll. 22.ii.1998, gam. 28.v.1998; PGB1, CEL,
coll. 10.x.1997, gam. 22.iv.1998; SBBB1, CEL, coll. 21.x.1997, gam.
29.xi.1997; SCR1, CEL/CWS, coll. 5.vi.1998, gam. 31.ix.1998. Middlesex
Co.—SR2, CWS, coll. 28.ix.1997, gam. 23.xii.1997. New Haven Co.—
DLF1, AN/CEL, coll. 15.xi.1997, gam. 13.1.1998; EMR1, AN/CEL, coll.
3.xii.1997, gam. 3.iii.1998. New London Co.—ARI1, CEL, coll. 23.v.1998,
gam. 7.vii.1998; BBS1, CWS, coll. 29.xi.1997, gam. 3.ii.1998; LBM1, CWS,
coll. 29.xi.1997, gam. 13.i1.1998: LEL1, CWS, coll. 29.xi.1997, gam.
10.11.1998; ST1, CEL, coll. 23.v.1998, gam. in field. Tolland Co.

gam. 10.x.1998; SKR1, CEL, coll. 11.xi.1997, gam. 12.i1.1998. Windham
Co.—NK1, AN/CWS, coll. 18.ix.1997, gam. 21.v.1998: NK7, MED/CWS,
coll. 29.ix.1998, gam. 22.x.1998: QR1, CEL, coll. 20.viii.1998, gam.
31.1x.1998.

throughout Connecticut (Figure 46) in river beds, drainage ditch-
es, and woodland trails—this species appeared in 20% of our
crude cultures. Often, samples containing this species did not ap-
pear as fertile siphons until two or more months in culture. In a
few instances, after being in culture for up to 3 months, V. aversa
became the dominant species in the crude samples, excluding
others.

Vaucheria aversa is one of two species in Connecticut, along
with V. bursata, with sessile gametangia. These two can be easily
distinguished by the angle and appearance of oogonia and by
antheridial morphology. Oogonia of V. bursata have completely-

1999] Schneider et al.—Vaucheria from Connecticut 239

filled cavities at maturity and have beaks that are directed at 70—
80° angles from the siphons towards the adjacent long, curled,
cylindrical antheridia (Figures 4-8). The oogonia of V. aversa
have peripheral cavities when mature and arise at 20—30° angles,
with their beaks deflected downwards to the siphons in the vicin-
ity of the adjacent short, straight, fusiform to cylindrical anther-
idia (Figures 1-3). Neither of these two could be confused with
any other freshwater Connecticut species.

Vaucheria bursata (O. F. Miill.) C. Agardh 1811, p. 21.
Figures 4-8, 47.
BASIONYM: Conferva bursata O. FE Miill. 1788, p. 96.
TYPE LOCALITY: Geneva, Switzerland.
NORTHEAST DISTRIBUTION: Maine, Mass., R.I., Vt., Conn., N.J.

REPRESENTATIVE COLLECTIONS: Fairfield Co.—CD1, CEL, coll. 31.v.1998,
gam. 28.vi.1998; CPG1, CEL, coll. 31.v.1998, gam. 6.vi.1998; KP1, CEL,
coll. 25.x.1998, gam. 28.x.1998; NB1, CEL, coll. 28.xi.1997, gam. 12.i.1998;
NCMI1, CEL, coll. 25.x.1998, gam. in field; MB1, CEL, coll. 28.xi.1997,
gam. 3.iii.1998; PN1, CEL, coll. 31.v.1998, gam. 6.vi.1998; WMR1, CEL,

CWS/CEL, coll. 5.vi.1998, gam. in field; FTS1, CWS, coll. 21.ix.1994, gam.
24.iv.1996; GSB1, CWS, coll. 12.xii.1997, gam. 3.ii.1998; NH1, CEL, coll.
8.x.1997, gam. 23.x.1997; PGB1, CEL, coll. 10.x.1997, gam. 17.x.1997;
RGB1, CEL/CWS, coll. 5.vi.1998, gam. 14.vi.1998; RP2, AN, coll.
13.xi.1997, gam. 29.xi.1997; TMR1, AN/CEL, coll. 1.x.1997, gam.
14.x.1997; WBB1, CWS, coll. 10.xii.1997, gam. 25.v.1998; WHR1, AN, coll.
13.xi.1997, gam. 2.xii.1997; WPF2, AN, coll. 7.x.1997, gam. 31.x.1997.
Litchfield Co.—BBR1, CEL, coll. 30.vii.1998, gam. 3.ix.1998; BNB1, CEL,
coll. 1.ix.1998, gam. 29.ix.1998; EA1, CEL, coll. 1.ix.1998, gam. in field;

OR2, CEL, coll. 30.vii.1998, gam. 21.ix.1998; KFB1, CEL, coll.
30.vii.1998, gam. 12.xi.1998; NCWRI1, CEL, coll. 30.vii.1998, gam
23.ix.1998. New London Co.—LBMI1, CWS, coll. 29.xi.1997, gam.
24.vi.1998; ST1, CEL, coll. 23.v.1998, gam. in field; TR2, AN/CEL, coll.
22.x.1997, gam. 1.xi.1997. Tolland Co.—SKR2, CEL, coll. 23.v.1998, gam.
9.ix.1998.

REMARKS. Vaucheria bursata was first reported in Connecticut as
V. sessilis (Vaucher) DC (Lamarck and de Candolle 1805) by
Hylander (1928) and Brown (1929). Vaucheria sessilis was
shown by Christensen (1973) to be a junior synonym of V. bur-
sata, based upon Miiller’s (1788) illustrations of Conferva bur-
sata, as well as collections Christensen made at Bad Meinberg,
southwest of Hanover, Germany. Blum (1972) maintained V. ses-

240 Rhodora [Vol. 101

silis and two similar species, V. repens Hassall and V. clavata
sensu Klebs, differentiating each by siphon diameter and number
of oogonia in association with each antheridium. Based upon our
collections of V. bursata from a variety of habitats in Connecticut,
we find these distinctions untenable, and follow Entwisle (1987,
1988a) in considering these as heterotypic synonyms of V. bur-
sata. For example, we have found individual siphons with one
and two oogonia associated with an antheridium. Our collections
of this cosmopolitan freshwater species come from all but two
counties in the state, Middlesex and Windham (Figure 47).
Vaucheria bursata appeared in 20% of our crudes cultures, thus
being one of the most commonly encountered species in the state.

Vaucheria compacta vat. compacta (Collins) Collins ex W. R.
Taylor 1937, p. 226. Figures 9-11, 48.
BasIONYM: Vaucheria piloboloides var. compacta Collins 1900,
pid.
TYPE LOCALITY: Malden Mass., United States.
NORTHEAST DISTRIBUTION (freshwater only): Conn.

COLLECTIONS: Fairfield Co.—CD1, CEL, coll. 31.v.1998, gam. 6.vi.1998;
BPG1, CEL, coll. 31.v.1998, gam. 6.vi.1998.

V. undulata and V. bursata, two other freshwater species, were
ound. These are the first low-salinity collections from the north-
east other than the records of its freshwater variety, V. compacta
var. dulcis (see below).

Vaucheria compacta is dioecious. After a month in freshwater

1999} Schneider et al.— Vaucheria from Connecticut 241

culture, both samples produced male gametangia only in the 16L/
8D photoperiod regime, with the samples in 8L/16D and 12L/
12D remaining vegetative. The antheridia were mostly of the typ-
ical “brackish-type,”” with two or more lateral discharge pores
(Figures 9, 10), not to be confused with those produced by V.
compacta var. dulcis that have one or no lateral discharge pores
(Figures 12, 13) (Schneider et al. 1996; Simons 1974). In both
Greenwich samples, the siphons produced male gametangia for
less than two weeks. Thereafter the cultures became overgrown
by other freshwater algal species including Vaucheria.

Vaucheria compacta var. dulcis J. Simons 1974, p. 624.
Figures 12, 13, 49.
TYPE LOCALITY: The Netherlands.
NORTHEAST DISTRIBUTION: Conn., Delaware.

REPRESENTATIVE COLLECTIONS: Hartford Co.—RPC, CWS, coll. 8.x.1992,
gam. 21.x.1992; FW, CWS, coll. 8.x.1992, gam. 26.x.1992; FP2, CEL/CWS,
coll. 5.vi.1998, gam. 24.vi.1998.

REMARKS. Despite our extensive collections of Vaucheria in the
state during all seasons over two years, we have not located this
freshwater variety of V. compacta in locations outside those in
the original report for North America of dense year-round pop-
ulations in the Connecticut and Farmington Rivers below the
Rainbow Dam (Figure 49; Schneider et al. 1996). These popu-
lations remain present and abundant only in areas of the Far-
mington River where they receive daily “‘hydrotidal”’ flooding
from the twice-daily hydroelectrical generation produced by the
dam, as well as natural tidal effects from Long Island Sound in
the Connecticut River. Schneider et al. (1996) speculated that the
variety’s exclusive distribution in Connecticut would be only to
areas receiving daily freshwater tidal flushing and this has been
borne out by a lack of collections from sites other than those in
the original report. We cannot speculate why this variety hasn’t
found its way to the lower Housatonic and Thames River systems,
as both are affected by tidal waters. In the Farmington River, V.
compacta var. dulcis thrives as thick continuous mat-like bands,
especially along the banks with the greatest flow of water, and
unlike other Vaucheria species in the state, it seems to grow to
the exclusion of other species (Schneider et al. 1996)
Despite years of culture work and field collections, we have

242 Rhodora [Vol. 101

yet to find or produce oogonia on plants from these sites, though
antheridia have been abundant (Schneider et al. 1996). Neverthe-
less, differences in the antheridial morphology allowed us to dif-
ferentiate this European variety from the nominate species,
Vaucheria compacta. The freshwater variety maintains its dis-
tinctive antheridial characteristics despite drastic salinity changes
in vitro (Schneider et al. 1996).

Vaucheria frigida (Roth) C. Agardh 1824, p. 173.
Figures 14-19, 50.
BASIONYM: Conferva frigida Roth 1797, p. 166.
TYPE LOCALITY: London, England.
NORTHEAST DISTRIBUTION: N.B., Maine, Mass., R.I., Conn., N.Y.

REPRESENTATIVE COLLECTIONS: Fairfield Co.—CPG1, CEL, coll. 31.v.1998
gam. 12.xi.1998; MBI, CEL, coll. 28.xi.1997, gam. 3.ii.1998: NR2, CEL
coll. 28.xi.1997, gam. 6.xii.1997; PB1, CEL, coll. 28.xi.1997, gam. 6.1.1998.
Hartford Co.—BBB2, CWS, coll. 10.xii.1997, gam. 6.1.1998; BUR1, CWS/
CEL, coll. 5.vi.1998, gam. 2.vii.1998; FS1, CWS, coll. 5.1x.1995, gam.
10.x.1995; JB1, AN, coll. 22.11.1998, gam. 28.v.1998: RGB2, CEL/CWS, coll.
5.vi.1998, gam. 17.vii.1998; WP2, AN, coll. 7.x.1997, gam. 29.xi.1997. New
London Co.—SDD1, CWS, coll. 29.xi.1997, gam. 3.1.1998. Tolland Co.—
RRB1, CEL, coll. 6.xi.1997, gam. 25.v.1998. Windham Co.—LR1, CEL,
coll. 20.viii.1998, gam. 12.xi.1998; NK3, AN/CWS, coll. 18.ix.1997, gam.
29.xi.1997.

?
'.

REMARKS. For much of its taxonomic history, Vaucheria frigida
was confused with another species originally described from Eu-
rope, V. terrestris (Vaucher) DC (Christensen 1968). Early North
American collectors apparently followed the account of V. ter-
restris by Gotz (1897), a taxon now considered distinct from true
V. terrestris (Blum 1972; Christensen 1968). Thus, early collec-
tions of V. frigida from Connecticut were reported as V. terrestris
(Blum 1953; Brown 1929; Hylander 1925, 1928), as well as dis-
tributed in the P.B.-A. exsiccata (Collins et al. 1895, no. 78a).
Vaucheria frigida occurs throughout North America, as well as
being cosmopolitan elsewhere, while V. terrestris is presently rec-
ognized only from Europe (Blum 1972). We have collected V.
frigida in all seven Connecticut counties, and it appeared in 13%
of our cultures (Figure 50).

In Vaucheria frigida, thick-walled oogonia are borne singly on
fruiting branches distal to single circinate antheridia. Long axes
of oogonia are projected either horizontally or directed back at

1999] Schneider et al.—Vaucheria from Connecticut 243

Figures 1-19. Connecticut freshwater Vaucheria species. 1-3. V. aversa;
4-8. V. bursata; 9-11. Antheridia of V. compacta var. compacta; 12-13.
Antheridia of V. compacta var. dulcis; 14-19. V. frigida. All scale bars =
100 pm.

244 Rhodora [Vol. 101

the supporting siphons bearing fruiting branches (pedicels). The
species can be confused with single oogonial forms of V. undu-
lata, but there are obvious differences between the two, not the
least of which are the spiraled siphons of the latter (see below).
Blum (1972) found considerably larger oogonia in V. frigida (80-—
135 X 106-165 wm) than in V. undulata (71-113 X 96-127 um).
Our collections as well yielded larger oogonia for V. frigida (81—
110 X 93-140 pm) than for V. undulata (50-80 * 60-100 pm),
but these had somewhat smaller dimensions than those listed by
Blum (1972). While V. undulata often bears reproductive branch-
es with a single oogonium, rarely are there vegetative siphons
without reproductive branches bearing two oogonia. As siphons
of V. undulata mature and bear more gametangia, the pedicels
usually proliferate from one another, a phenomenon only ob-
served once in eighteen fertile collections of V. frigida, and not
nearly to the extent of that seen in V. undulata (see below).

Vaucheria geminata (Vaucher) DC in Lamarck et DC 1805, p.
62. Figures 20-22, 51.
BaSIONYM: Ectosperma geminata Vaucher 1803, p29.
TYPE LOCALITY: Between Geneva and Versoix, Switzerland.
NORTHEAST DISTRIBUTION: Maine, N.H., Vt., Mass., Conn., N.J.

REPRESENTATIVE COLLECTIONS: Fairfield Co.—BSP1, CEL, coll. 31.v.1998,
gam. 6.vi.1998; BUR1, CEL/CWS, coll. 5.v.1998, gam. 28.vi.1998; NB1,
CEL, coll. 28.xi.1997, gam. 25.v.1998; PB1, CEL, coll. 28.xi.1997, gam.
22.iv.1998. Hartford Co.—EGST, CWS, coll. 12.xii.1997, gam. 3.ii.1998;
GMS1, CEL/CWS, coll. 5.vi.1998, gam. 14.vi.1998; LJB1, AN, coll.
22.ii1.1998, gam. 14.iv.1998; LV1, CEL, coll. 21.x.1997, gam. 29.xi.1997;
NBBB1, CWS, coll. 8.xi.1997, gam. 3.i.1998: NH1, CEL, coll. 8.x.1997, gam.
23.x.1997; QP1, AN/CEL, coll. 1.x.1997, gam. 22.iv.1998; SCR1, CEL/CWS,
coll. 5.vi.1998, gam. 14.vi.1998; WHR1, AN, coll. 13.xi.1997, gam.
2.xii.1997. Litchfield Co—HOR2, CEL, coll. 30.vii.1998, gam. 20.xi.1998.
Middlesex Co.—SR2, CWS, coll. 28.ix.1997, gam. 11.x.1997. New London
Co.—CCRI, CEL, coll. 23.v.1998, gam. 6.vi.1998; LBM1, CWS, coll.
29.ix.1997, gam. 16.ii.1998; SDD1, CWS, coll. 29.ix.1997, gam. 22.iv.1998;
ST1, CEL, coll. 23.v.1998, gam. 14.vi.1998. Windham Co.—NK3, AN/CWS,
coll. 18.ix.1997, gam. 15.x.1997.

REMARKS. Collins et al. (1905) first reported Vaucheria geminata
from Connecticut, followed by the reports of Hylander (1925,
1928), and in this study it was collected in 18% of our samples
from throughout the state (Figure 51).

Vaucheria geminata almost invariably produces two opposite

1999} Schneider et al.—Vaucheria from Connecticut 245

oogonia on short to slightly extended pegs off erect reproductive
branches at abaxial angles of 50—70° (Figures 21, 22). In a few
instances, we found reproductive branch proliferation (Figure 20),
a phenomenon also noted by Christensen (1969; fig. 9837a, i) for
V. geminata. The oogonia are ovoid to slightly reniform in shape
(Figures 20-22) and range from 60-78 X 62-90 um. Circinate
antheridia are borne singly and terminally in between and distal
to the oogonia, but mostly not projecting beyond the height of
the oogonia (Figures 20-22). Fertile V. geminata appear very
similar to forms of V. taylorii that bear two oogonia on repro-
ductive branches (see below), with the distinguishing characters
of not-overly-swollen pedicels (often distinctly swollen in V. tay-
lorii) and the height of antheridia (V. taylorii mostly has its an-
theridia exceeding the tops of the oogonia on pedicels). Oogonia
are often distinctly flattened on adaxial surfaces in V. taylorii (see
below), a characteristic not seen in V. geminata. As discussed
later in this report, the Connecticut specimens of V. geminata and
its var. racemosa distributed in P.B.-A. (XXVI:1287), are now
seen to be a polymorphic collection of V. taylorii.

*Vaucheria prona T. A. Chr. 1970, p. 250. Figures 23-27, 52.
TYPE LOCALITY: Kongelunden, Amager, Denmark.
NORTHEAST DISTRIBUTION: Mass., Conn.,

REPRESENTATIVE COLLECTIONS: Fairfield Co.—BSP1, CEL, coll. 31.v.1998,
gam. 6.vi.1998; NR2, CEL, coll. 28.ix.1997, gam. 6.xii.1997; PB1, CEL, coll.
28.ix.1997, gam. 22.iv.1998; SNR1, CEL, coll. 25.x.1998, pam. in field. Hart-

aZai. 1998, gam. 3.xi.1998; GRDD1, AN, ‘coll. 224 ii. 1998, gam. 22.4 iv. ‘1998:

coll. 22.ii.1998, gam. 14.iv.1998. New London Co.—BBS1, CWS, coll.
29.xi.1997, gam. 3.11.1998; RRD1, AN/CEL, coll. 22.x.1997, gam
ey Ses AN/CEL, coll. 22.x.1997, gam. 28.x.1997. Tolland Co.—
SKR2, , coll. 23.v.1998, gam. 28.vi.1998. Windham Co.—NK3, AN/
CEL, coll. > th ix.1997, gam. 29.xi.1997.

REMARKS. Previously encompassed under Vaucheria terrestris
(Vaucher) DC (=V. frigida), Christensen (1970) separated V.
prona from it, as the former had only a single pendent oogonium
on a fertile branch. He noted that his paired, pendent oogonial

246 Rhodora [Vol. 101

plants actually represented what was later called V. hamata sensu
Gétz (1897). In order to avoid continued taxonomic confusion,
V. prona was established as a new species to accomodate this
paired oogonial alga rather than reintroducing new concepts for
long-established taxa (Christensen 1970). This common alga was
designated by early North American workers as V. hamata, and
is now recognized from collections from throughout the world
(Entwisle 1988a). Our isolates of V. prona represent the first re-
cords of this species from Connecticut, and only the second from
New England. This species was found in 16% of our samples,
but not in Litchfield, New Haven, and Middlesex counties (Figure
52).

Oogonia on Vaucheria prona, like those of V. frigida, are
formed distally to single antheridia on fertile branches, and are
pendent on downwardly curved pegs off curved fertile branches.
In some cultures, gametangia were formed terminally on the si-
phons themselves or on greatly extended fruiting branches. In V.
prona there are usually two large oogonia (42-68 X 55-78 jum)
found on each fruiting branch, and when fully mature have op-
positional tips (Figures 24, 26). Occasionally, we have found
fruiting branches proliferating from others, while retaining two
oogonia on the basal fruiting branch. Such occurrences are not
nearly as common as those in V. undulata, a species that normally
retains only a single oogonium on the basal branch. At one site
(HLM), we often found V. prona producing three or four oogonia
per pedicel (Figure 23), and in rare instances, we have found
siphons producing only a single oogonium on a fertile branch
(Figure 25). The multiple oogonial form is easily distinguished
from V. taylorii by its pendent oogonia, a phenonmenon also
nicely illustrated in Australian populations of this species (En-
twisle 1988a; figs 85, 90). However, the single oogonial form of
V. prona is difficult to distinguish from the single forms of V.
frigida and V. undulata. Careful observations of large populations

; as trademark spiraled
siphons (Figure 39) and, at maturity, consistently produces pro-

re one oogonium in an op-

1999] Schneider et al.—Vaucheria from Connecticut 247

posite pair would have formed on a reproductive branch (see
below). Vaucheria prona can be distinguished from the other lo-
cal species with opposite oogonia, V. geminata, as this species
has erect oogonia on straight reproductive branches (Figures 20—
22; Entwisle 1988b).

ee iota taylorii Blum 1971, p. 191. Figures 28-34, 53.
TYPE LOCALITY: Beaver Is., Charlevoix Co., Mich., United
a

NORTHEAST DISTRIBUTION: Maine, Conn.

COLLECTIONS: Fairfield Co—KP1, CEL, coll. 25.x.1998, gam. in field;
NB1, CEL, coll. 28.xi.1997, gam. 12.i.1998. Hartford Co.— ir, CeEs
CWS, coll. 5.v.1998, gam. 29.vii.1998; FTS1, CWS, coll. 21.ix.1994, gam.
5.x.1994; GSB2, CWS/CEL, coll. 5.vi.1998, gam. 11.ix.1998; NRS1, CWS/
CEL, coll. 5.x.1998, gam. 30.xi.1998; WPI, AN, coll. 7.x.1997, gam.
14.x.1997. Litchfield Co.—EA1, CEL, coll. 1.ix.1998, gam. 24.x.1998;
HOR2, CEL, coll. 30.viii.1998, gam. 21.ix.1998; KFB1, CEL, coll.
30.viii.1998, gam. in field; NN1, CEL, coll. 1.ix.1998, gam. 21.ix.1998. New
London Co.—ST1, CEL, coll. 23.v.1998, gam. 14.vi.1998

REMARKS. Although our recent collections represent the first report
of this species from Connecticut, specimens of Vaucheria taylorii
were actually distributed in P.B.-A. (Collins et al. 1905) as V.
geminata (Ash Creek, Bridgeport, Conn., Holden 9.iv.1892, no.

287). Collins et al. (1905) noted that this dried specimen con-
tained “mostly the type [of V. geminata], but with some var.
racemosa,” this being the sole basis for Hylander’s (1928) report
of V. geminata var. racemosa [=V. racemosa (Vaucher) DC], a
species we have not found in our extensive collections here. We
have examined this exsiccata and have established that specimen
no. 1287 represents a collection of V. taylorii with 2-6 oogonia
on fertile branches rather than the two species proposed in the
exsiccata. Also, as will be shown below, the illustration of V.
geminata in Hylander (1928; pl. XX, Fig. 8), could possibly rep-
resent V. taylorii depending upon the other reproductive branches
that may have been associated with it in its original population.
The oogonia of V. taylorii are borne at erect angles on pegs from
the fruiting branches curving inwardly, often with their tips point-
ing towards terminal antheridia. Vaucheria racemosa can easily
be distinguished by its downcurved, long pegs from fertile
branches bearing pendent oogonia (Blum 1972). Vaucheria ra-
cemosa is in fact more similar to multiple oogonial forms of V.

[Vol. 101

Figures 20-34. Connecticut freshwater Vaucheria species. 20-22. V.
geminata; 23-27. V. prona; 28-34. V. taylorii. All scale bars = 100 Lm.

1999] Schneider et al.—Vaucheria from Connecticut 249

prona, but that species has long fruiting branches while those in
V. racemosa are distinctly smaller (Blum 1972)

The antheridial pedicels of Vaucheria taylorii project at least
to the same height as the tops of oogonia (Figures 28, 30), usually
exceeding them and at times being significantly higher (Figures

, 34), one of the characters used to distinguish it from V. gem-
inata (Blum 1971). Vaucheria taylorii is further noted by its
swollen pedicels (Blum 1971), yet this character is variable

and between the various collections we and others have
made (Figures 28-34). Still, unlike V. geminata, some of the re-
productive branches of V. taylorii in a population will be signif-
icantly swollen centrally where oogonial pegs are formed (Figures
28, 31, 32). Oogonia range from 61-91 X 64-92 ym, and show
a trend from larger and distinctly flattened on adaxial surfaces
when only two are formed on a reproductive branch (Figure 29),
to smaller and ovate to reniform when present in whorls of three
to six (Figures 28, 32).

e only other species we have found with more than two
oogonia per fertile branch, Vaucheria prona, is easily distin-
guished by its markedly pendent oogonial pegs (Figure 23).
Along with V. compacta, V. taylorii is one of the least prevalent
freshwater species in Connecticut, appearing in only 8% of our
collections (Figure 53).

*Vaucheria uncinata Kiitz. 1856, p. 21. Figures 35-38, 54.
TYPE LOCALITY: Freiburg, Germany.
NORTHEAST DISTRIBUTION: Maine, N.H., Mass., Conn., N-Y.

REPRESENTATIVE COLLECTIONS: Fairfield Co.—SNR1, CEL, coll. 25.x.1998,
gam. in field; NB1, CEL, coll. 28.xi.1997, gam. 25.v.1998. Hartford Co.—
BBB2, CWS, coll. 10.xii.1997, gam. 13.i.1998; BUR1, fe ae coll.
5.vi.1998, gam. 28.vi.1998; CM1, CEL, coll. 1.ix.1998, gam. 10.ix.1998;
FS3, CWS/CEL, coll. 5.vi.1998, gam. 28.vi.1998; GMS2, "CWSICEL. oul:
5.vi.1998, gam. 28.vi.1998; GRDD1, AN, coll. 22.11.1998, gam. 28.v.1998
GSB2, CWS/CEL, coll. 5.vi.1998, gam. 28.vi.1998; RGB2, CWS/CEL, coll.
5.vi.1998, gam. 28.vi.1998; SCR1, CEL/CWS, coll. 5.vi.1998, gam.
14.vi.1998. Litchfield Co.—PTB1, CEL, coll. 1.ix.1998, gam. 1.x.1998. Mid-
dlesex Co.—SR2, CWS, coll. 28.ix.1997, gam. 11.x.1997. New London
Co.—AR1, CEL, coll. 23.v.1998, gam. 7.vii.1998; CCR1, CEL, coll.
23.v.1998, gam. 28.vi.1998; HVP1, CEL, coll. 23.v.1998, gam. 7.vii. 1998.
LBM1, CWS, coll. 29.xi.1997, gam. 24.vi.1998; ST1, CEL, coll. 23.v.1998,
gam. 17.vii.1998; TR1, AN/CEL, coll. 22.x.1997, gam. 28.x.1997. Tolland
Co.-—CB1, CEL, coll. 11.ix.1997, gam. 3.i1.1998;; RRB, CEL, coll.

250 Rhodora [Vol. 101

6.ix.1997, gam. 22.iv.1998. Windham Co.—NK1, AN/CWS, coll. 18.ix.1997,
gam. 30.ix.1997; NK7, MED/CWS, coll. 29.ix.1998, gam. in field.

REMARKS. The complicated taxonomic and nomenclatural history
of this species is summarized by Blum (1953). Our collections
represent the first record of Vaucheria uncinata for Connecticut,
although Blum (1972) reported its distribution throughout the
continental United States. It is a somewhat common species in
our collections, found in 15% of all sites sampled, occurring al-
most exclusively in the Connecticut River Valley or to the east
of the Connecticut River (Figure 54). We rarely found V. uncinata
on mud saturated with water in the field and it only appeared in
our cultures when the crude samples became somewhat dried.

Vaucheria uncinata is easily distinguished from the other local
species by its unusually large, transversely elongated, pendent
oogonia (108-150 wm in greatest dimension) that often appear to
be sessile on the siphons due to their terminal position on long,
hooked, or gallows-shaped, reproductive branches (Figures 35—
38). In certain locations during the fall, we have found fertile V.
uncinata growing as an extensive mat over mud in non-flowing
intermittent streams.

*Vaucheria undulata C. C. Jao 1936, p. 741.
Figures 39—45, 55
TYPE LOCALITY: Fou-tu-Kuan, Szechwan, China.
NORTHEAST DISTRIBUTION: Maine, Mass., Conn., RA. NY.) NJ.

REPRESENTATIVE COLLECTIONS: Fairfield Co.—AC1, CEL, coll. 30.viii.1998,
gam. 18.ix.1998; BSP1, CEL, coll. 31.v.1998, gam. 6.vi.1998: CD1, CEL,
coll. 31.v.1998, gam. 14.vi.1998; CPG1, CEL, coll. 31.v.1998, gam.

BRWB, CWS, coll. 12.xii.1997, gam. 23.v.1998; CP1, AN, coll. 22.11.1998,
gam. 3.ix.1998; FMT1, CEL, coll. 25.x.1998, gam. 12.xi.1998: FWB1, CEL/
CWS, coll. 5.vi.1998, gam. 6.x.1998; GMS1, CEL/CWS, coll. 5.vi.1998, gam.
28.vi.1998; GRDD1, AN, coll. 22.11.1998, gam. 30.v.1998: MP1, CEL, coll.
8.x.1997, gam. 15.x.1997: RGB2, CEL/CWS, coll. 5.vi.1998, gam

gam. in field; PTB1, CEL, coll. 1.ix.1998, gam. 23.ix.1998. Middlesex Co.—
SR2, CWS, coll. 28.ix.1997, gam. 23.xii.1997. New Haven Co.—DL1, CEL/

1999] Schneider et al.—Vaucheria from Connecticut 251

Figures 35-45. Connecticut freshwater eis al species. 35-38. V. un-
cinata; 39—45. V. undulata. All scale bars = 100 p

252 Rhodora [Vol. 101

coll. 23.v.1998, gam. 17.vii.1998; LBM1, CWS, coll. 29.xi.1997, gam.
24.vi.1998; TAB1, CEL, coll. 23.v.1998, gam. 17.vii.1998; TR1, CEL/AN,

RRB1, CEL, coll. 6.xi.1997, gam. 20.v.1998: TD1, CWS, coll. 5.x.1997, gam.
10.x.1997; US1, CWS, coll. 7.xii.1997, gam. 28.v.1998. Windham Co.—BK1,
CEL, coll. 20.viii.1998, gam. 28.i.1999; LR1, CEL, coll. 20.viii.1998, gam.
12.xi.1998; NK1, AN/CWS, coll. 18.ix.1997, gam. 16.vi.1998; NK7, MED/
CWS, coll. 29.ix.1998, gam. in field; QR1, CEL, coll. 20.viii.1998, gam.
10.ix.1998.

REMARKS. Since its description from Szechwan, Vaucheria un-
dulata, with its trademark spiraled siphons, has been found in
many New England locations (Blum 1972; Colt 1985), and here
we add it to the flora of Connecticut. We have found this species
to be widespread throughout the state (Figure 55), and it was the
most prevalent species in our crude cultures (39%). In the past,
V. undulata was undoubtedly misidentified as other species, col-
lectors not recognizing it by the majority of siphons that develop
spirally at the tips (Figure 39). However, if gametangia are found
on a siphon lacking spiraled development, they could easily be
confused with V. frigida or V. prona, due to similar gametangial
morphology and position. All three species have pendent oogonia
that are borne on fruiting branches distal to single circinate an-
theridia, V. undulata and V. frigida mostly with one oogonium
per fruiting branch, V. prona usually with two. Unlike the others,
V. undulata oospores often turn light brown prior to release from
the mother siphon. Occasionally, V. taylorii produces a few un-
dulating (spiraled?) siphons in a population, but the reproductive
branches of the two species are distinct.

diameter axes were usually spiraled, while those of greater di-
ameter were mostly undulate to subundulate. In our cultures, the
filaments were found to be of a similar dimorphic range, with
approximately 60% showing spiral development in both size clas-
ses. Our small-diameter siphons were distinctly spiraled, while

1999] Schneider et al.—Vaucheria from Connecticut 253

the larger ones (mature?) were more swollen and appeared to be
undulate. Furthermore, only the larger-sized siphons in our cul-
tures produced gametangia. Oogonia in Connecticut populations
anged from 50-80 x 60-100 um. The reproductive branches
ans proliferated at maturity, a phenomenon seen only oc-
casionally in other species such as V. frigida, V. prona, and V.
geminata (Figure 20), but never to the extent of V. undulata. New
es branches were produced at the site where an oppo-
oogonium would have formed on the previous pedicel in the
same system (Figures 40, 41, 43), often repeating this develop-
ment sequentially (Figures 42, 44). In our crude cultures, V. un-
dulata often grew to the exclusion of other Vaucheria species,
the latter only appearing after the bloom of V. undulata had
passed (5—6 weeks).

KEY TO THE FRESHWATER SPECIES OF VAUCHERIA IN CONNECTICUT

1. Antheridia and oogonia on separate plants (dioecious) .... 2
1. Antheridia and oogonia on the same plants (monoecious) ... 3
2. Antheridia with 1 terminal and mostly 2 lateral discharge
pores (Figures 9-11) .... V. compacta var. compacta

2. Antheridia with 1 terminal and 1 or 0 lateral discharge
potes (Figures IZ. 13)". ...... V. compacta var. dulcis

3. Oogonia and antheridia sessile or short-stalked on siphons, not
borne on special bisexual fruiting branches (pedicels) ... 4

3. Oogonia and antheridia borne on special bisexual fruiting
5

4. Oogonia formed singly or in pairs with long, circinate an-
theridia between them; oospores completely filling oo-
gonial cavities at maturity; oogonial beaks oriented to-
ward the antheridia, either parallel with the siphons or
erect at oblique angles (Figures 4-8) ..... V. bursata

4. Oogonia formed singly, never paired around a single an-
theridium, usually with small, cylindrical antheridia on
both sides; oospores with obvious distal and peripheral
oogonial cavities at maturity; oogonia with deflected
beaks directed towards the siphons (Figures 1-3) ....

Lita SE GEO ae Fe PRR we Saeed ia ae ree V. aversa
5. Oogonia formed singly on fruiting branches ............. 6
5. Oogonia usually 2 or more on each fruiting branch ...... i

6. Oogonia subspherical to transversely elongate, lacking

254 Rhodora [Vol. 101

s©

aks, pendent on hooked or gallows-shaped pedicels

Ciianies SSO inti ec ee t.. Peve ree V. uncinata

6. Oogonia subspherical to obovate and reniform with small
distal beaks, borne terminally on curved pedicels (Fig-

pies Pdi cis. oo See Sa es V. frigida
Population rarely containing spiraled siphons; oogonia almost
always 2 per fruiting branch (occasionally 1 or 3—4, but
these oogonia pendent), borne laterally to terminal erect
antheridia; if proliferating additional fruiting branches,
usually 2 oogonia maintained on the basal fruiting branch
(Figure 20)

. Population often containing spiraled siphons; oogonia highly

variable in number per fruiting branch; if proliferating ad-
ditional fruiting branches, usually 1 oogonium maintained
on the basal fruiting branch (Figures 40-42) .........
8. Oogonia pendent on obvious downcurved pegs, occasion-
ally numbering 3—4 (Figure 23); fruiting branches usu-
ally curved (Figures 24-27) .............. V. prona
8. Oogonia erect on pegs and directed away from siphons,
almost uniformly numbering 2; fruiting branches
straight and erect (Figures 20-22) ..... V. geminata
Siphons commonly spiralling, especially the thinner ones in a
population (Figure 39); oogonia | or 2 per fruiting branch,
with variation common on individual siphons; fruiting
branches commonly proliferating in chain-like fashion
from one another at maturity (Figures 40—44); fruiting
branches not swollen at points of oogonial attachment at
Soturity. (PTS Oren Se oe a me woe os V. undulata
Siphons only occasionally spiralling; 2 to 6 oogonia per fruit-
ing branch, with great variation common on individual
siphons; fruiting branches distinctly swollen at points of
oogonial attachment at maturity (Figures 28-34)
ei oa poe! big a Sin es etamiereialiavags GAR a3) acaatwid ac V. taylorii

ACKNOWLEDGMENTS. We thank Courtney Hadly, Megan Dun-

phy, Megan Garretson, and Ginny Schneider for their assistance
on this project both in the field and in the lab. We acknowledge
a Trinity College student research grant from the Faculty Re-
search Committee to CEL. We appreciate the constructive criti-
cism of the manuscript provided by Dr. Arthur Mathieson (UNH).

255

Schneider et al.— Vaucheria from Connecticut

V. aversa

1999]

mea de co
COAT weet eee aly gow

ary
7 tS

“a Los

aa ae

oe Oe P< dis

te Sy Sy aa Saree — ae
SPR FLAG SEN ek a) Se
oN PRD een fats oe bee

Thames R.

*
’
'
4

3 . a y \ , S ’ .
(ge eceage Sa

os
-#
‘

Ane
ee
J

dee te

Connecticut R.

ie ¥
Te ~ J
Fat

ba)
1+.
*,

=:
bi ~ bf oy. q *
mre Ae ey eg
big oy 2 . ey s
: aes Sem to
: ; VX tie

mo * thal - i
= : ae
: i“
Re DEANS
: FP’! ee es
rk Lv . ‘

V. bursata

Figures 46—47. Distribution maps of Connecticut freshwater Vaucheria

species.

Thames R.

wae!
ou
SS
‘a

fap ae ahs

ot sae

ot te

256 Rhodora [Vol. 101

V. compacta var. compacta
Viet.
es
7 ke
1a,

uP PS fe ASG
on rene
“$s be ne
ig gt er ay
4 7X i ts
ae Are

mile

: r as fA aes c
TY te ee
- a Hy

49. Distribution maps of Connecticut freshwater Vaucheria

Figures 48—
pecies.

257

Schneider et al.—Vaucheria from Connecticut

1999]

ida

sit

"rh
Lone.
nh tre td
pent

Thames R.

Connecticut R

ipl

ea!

Thames R.
Distribution maps of Connecticut freshwater Vaucheria

a4
5

ech o'r,
= Pace) on = ee c 3)
ie 1 eos a =
phic Nv if agree Y
bide eee 3 7 x =
A eae aan xt Nees =
re sek wie }
4 ed le oS ae ee By

Eile cee ea ee
“40 q ayo pbs 0 2425

* Housatonic R.

Figures 50-51.

species.

[Vol. 101

Rhodora

:
ee > oN De gs eae YF
vo nThn “A ae ay = ara aR,

apes Tele ae ee ee aie elt 4

. - - sa ci o>

ats IAD AX ot Oo

Thames R
Distribution maps of Connecticut freshwater Vaucheria

oy
‘
Thames R.
52

Connecticut R.

hae ate

a a

~ Housatonic R.

Fie Laks

258

V. prona

V. taylorii

Figures 52-53.

species.

Schneider et al.—Vaucheria from Connecticut 259

1999]

inata

uncina

(‘AP
coon ama |
7h

ee
war koe:

Thames R.

Connecticut R.

ousatonic R

V. undulata

Thames R.

Connecticut R.

Distribution maps of Connecticut freshwater Vaucheria

Figures 54-55.

species.

260 Rhodora [Vol. 101

LITERATURE CITED

AGARDH, C. A. 1811. Dispositio Algarum Sueciae. . . Part 2. Berling’s Print-
ing Office, Lund.

. 1824. Systema Algarum. Lund.

BIsCHOFF, H. AND H. C. BoLp. 1963. Phycological studies. IV. Some soil
algae from oe Rock and related algal species. Univ. Texas Publ.,
No. 6318

Buu, J. L. ioe i, racemose Vaucheriae with inclined or pendent oogonia.
Bull. Torrey Bot. Club 80: 478-497.

1971. Notes on American Vaucheriae. Bull. Torrey Bot. Club 98:

189 194,
wa P12: eo sega 8 North American Flora. Series II, Part 8, pp.
1 63, New York Botanical Garden, New York.

and J. T. Coneuall 1953. New or noteworthy Vaucheria from New
England salt marshes. Biol. Bull. Mar. Biol. Lab. Woods Hole 105: 395—

Brown, H. J. 1929. The algal family Vaucheriaceae. Trans. Amer. Microscop.
Soc. 48: 86-102.

Brummit, R. K. AND C. E. Powel, eds. 1992. Authors of Plant Names.
R Botanic Gardens, Kew
CHRISTENSEN, T. 1968. Vaucheria types in the Dillenian herbaria. Brit. Phy-
col. Bull. 3: 463-469.
. 1969. Vaucheria collections from Vaucher’s region. Kongel. Danske
Vidensi, Selsk. Biol. Skr. 16: 1-36.
1970. Vaucheria prona, a new name for a common alga. Bot.
Tidsskr. 65: 245-251.
1973. Some early Vaucheria descriptions. Bot. Not. 126: 513-518.
1987. Seaweeds of the British Isles, Vol. 4, Tribophyceae (Xantho-
since British Museum (Natural History), London.
88. Salinity preference of twenty species of Vaucheria (Tribophy-
ae). J. Mar. Biol. Assoc. U.K. 68: 531-545.
Cou E S. 1900. eee lists of New England plants, —V. Marine
ae. Rhodora 2: 41-5
9. The green ve of North America. Tufts Coll. Stud., Sci. Ser.
Z: a 480.
» I. HOLDEN, AND W. A. SETCHELL. 1895. Phycotheca Boreali-Ameri-
cana ae Algae of North America. Fascicle II. No. 51— 100, Mal-
den, MA

—_, ——_, ———.. 1898. Phycotheca Boreali-Americana (Exsic-

cata), Alene ae thon America. Fascicle X. No. 451-500, Malden, MA.
——_, - 1905. Phycotheca Boreali-Americana (Exsic-
cata), ‘Alene of North Amecina Fascicle XXVI. No. 1251— 1300, Malden,

Coirsi. ron Jr. 1985. Vaucheria undulata Jao again in New England. Rho-
dora 87: 597-599.

Conn, H. W. AND L. W. Wesster. 1908. The algae of the fresh waters of
Connecticut. Connecticut State Geol. Nat. Hist. Surv. 10: 5-73.

1999] Schneider et al.—Vaucheria from Connecticut 261

DumortigER, B.-C. 1822. Commentationes botanicae. Observations bota-
ques. Tournay.

ENTWISLE, T. J. 1987. An evaluation of taxonomic characters in the subsection
Sessiles, section Corniculatae, of Vaucheria (Vaucheriaceae, Chrysophy-
ta). Phycologia 26: 297-321.

1988a. A monograph of — aes IN Ken al in

southeastem mainland Australia. A Bot. 1: 1-77.

. 1988b. An evaluation of seconde characteristics in the Vaucheria
prona prong ni (Vaucheriaceae, eereek vite Phycologia 27: 183-200.

FaHey, E. M. AND M. S. Dory. 1955. An alphabetical index to the Phycotheca
plone Unpublished mimeograph, Woods Hole, MA

Gotz, H. 1897. Zur systematik der gattung Vaucheria DC speciell der arten

134.

HassaL, A. H. 1843. Descriptions of British freshwater confervae, mostly
new, with observations on some of the genera. Ann. Mag. Nat. Hist. 11:

428-437.
HyLanber, C. J. 1925. Vaucheria. pp. sage In: The algae of Connecticut.
. dissertation, Yale Univ., New He
: 192 28. The algae of Connecticut. psa State Geol. Nat. Hist.
Surv. 42: 9-245.
Jao, C.-C. 1936. Studies on the freshwater algae of China. II. Vaucheriaceae
from Szechwan. Sinensia 7: 730-747.
KUTzING, FE. T. 1856. Tabulae Phycologicae. .. Vol. 6. Nordhausen
Lamarck, J.-B., P. A. DE CANDOLLE, AND A. P. DE CANDOLLE. 1805. Flora
Francaise, troisiéme édition, Vol. 3. Paris.
MULLER, O. F. 1788. Histoire de confervis palustribus oculo nudo invisibi-
ibus. ose Acta Acad. Sci. Imp. Petrop. 3: 89-98.
Pecora, R. A. 1977. Brackish water species of cin ag oe
Vaucheriales) from Louisiana and Texa: oun eee 5-0.
Rot, A. W. 1797. Catalecta Botanica. . ig LG. Ske. Leipzig.
SCHNEIDER, C. W., L. A. MACDONALD, J. F. ae AND S. W. HEMINWAY.
1993. The marine and brackish water species of aowpeoy (Tribophy-
ceae, et ceo from Connecticut. Rhodora 95: 97-11
: . Ritey, AND B. M. StTockTON. 1996. Stability - antheridial
Cal eg in freshwater North American Vaucheria compacta var. dul-
cis J. Simons (Tribophyceae, "neil grown under different salin-
ities. Aquatic Bot. 52: 301-31
Simons, J. 1974. Vaucheria ee. A euryhaline estuarine algal species.
Acta Bot. Neerl. 23: 613-626.
TAYLor, W. R. 1937. Notes on North Atlantic marine algae. I. Pap. Michigan
cad. Sci. 22: 225-233.
VAUCHER, J. P. 1803. Histoire des Conferves d’Eau Douce. J. J. Paschoud,
Geneva

APPENDIX
FRESHWATER COLLECTION SITE CODES.

AB — Tolland Co.: Ash Brook, Coventry.
AC — Fairfield Co.: Ash Creek, Bridgeport.

Rhodora [Vol. 101

AR — New London Co.: Blissville Brook, Lisbon.

BBB — Hartford Co.: Beamans Brook, Bloomfield.

BBR — Litchfield Co.: Blackberry River, North Caanan.

BBS — New London Co.: Big Brook, Salem.

BK — Windham Co.: Blackwell Brook, Brooklyn.

BNB — Litchfield Co.: Butternut Brook, Litchfield.

BPG — Fairfield Co.: Bruce Park, Greenwich.

BRWB — Hartford Co.: Tunxis Floodwater Retention Reservoir, Wash
Brook, Bloomfield.

CM — Hartford Co.: Copper Mine Brook, Bristol.
CP — Hartford Co.: Covilli’s Pond, Canton
CPG

FW — Hartford Co.: Farmington River, Windsor.

FWB — Hartford Co.: Freshwater Brook, Enfield.

GMS — Hartford Co.: Mountain Brook, Great Marsh, Suffield.
GRDD — Hartford Co.: Gracey Road drainage ditch, Canton.

GSB — Hartford Co.: Salmon Brook, Granby.

HB — New Haven Co.: Junction Route 5 and Interstate 691, Meriden.
HLM — Hartford Co.: Hockanum River, Laurel Marsh, Manchester.
HOR — Litchfield Co.: Housatonic River, Sharon.
JB — Hartford Co.: Jim Brook, Canton.

LBM — New London Co.: Latimer Brook, Montville.
LEL — New London Co.: Latimer Brook, East Lyme.

MP — Hartford Co.: Drainage catchment basin (pond), Interstate-84,
Manchester.

1999] Schneider et al.—Vaucheria from Connecticut 263

NB — Fairfield Co.: North Brook, Newtow

NBBB — Hartford Co.: North Branch Bini Brook, Burlington.
NCM — Fairfield Co.: Mill Pond, New Caanan

NCWR — Litchfield Co.: Witing River, North Caanan.

NH — Hartford Co.: Drainage ditch, Route 30, South Windsor.
NK — Windham Co.: Nipmuck Trail, Ashford.

NN — Litchfield Co.: Nonnewaug River, Woodbury.

NRS — Hartford Co.: Floodplain vic. Wells Pond, West Hartford.
PB — Fairfield Co.: Patterson Brook, Easton.

PBW — Hartford Co.: Phelps Brook, Windsor.

PGB — Hartford Co.: Plum Gully Brook, South Windsor.

RGB — Hartford Co.: Rocky Gutter Brook, deste

RP — Hartford Co.: Reservoir pond, West Hart

RPC — Hartford Co.: Riverside Park, Cones River Hartford.

RRB — Tolland Co.: Valley Falls Park, Vi

RRD — New London Co.: Drainage eh, ‘el Road, Norwich.

SBBB — Hartford Co.: South Branch Bunnel Brook, Burlington.

SCR — Hartford Co.: Scantic River, Enfield

SDD — New London Co.: Route 11 drainage pond, junction Route 82,
Salem

SKR — Tolland Co.: Skungamaug River, Coventry.

SNR — Fairfield Co.: South Norwalk Reservoir, Wilton.

TMR — Hartford Co:: Lazy Lane Road, Southington

TSB — New Haven Co.: Transylvania Brook, Southbury.

US — Tolland Co.: Stream, Route 171, Union.

WBB — Hartford Co.: Wash Brook, Bloomfield.

WBSP — New Haven Co.: Wharton Brook State Park, outlet brook,
Wallingford.

WCP — Hartford Co.: Woodridge Circle Pond, Canton.

WHR — Hartford Co.: West Hartford Reservoir, West Hartford.

WMR — Fairfield Co.: Stream, Wire Mill Road, Stamford.

WP — Hartford Co.: Wells Pond, West Hartford.

WPF — Hartford Co.: Wells Pond feeder stream, West Hartford.

RHODORA, Vol. 101, No. 907, pp. 264—273, 1999

DISTURBANCE AS A FACTOR IN THE DISTRIBUTION
OF SUGAR MAPLE AND THE INVASION OF NORWAY
MAPLE INTO A MODIFIED WOODLAND

REBECCA ANDERSON!
Tufts University, Biology Department, Medford, MA 02155

ABSTRACT. Disturbances have the potential to increase the success of bi-
ological invasions. Norway maple (Acer platanoides), a common street tree

&
@
5
-
o
2)
-
a
@
g
ct.
=
By
5
5
E
a
5
=
=
&
n
=
a9
5
yd
®
>
®
™
s
8
>
:
3
—
z.

invasion of Norway maple and in the distribution of sugar maple. Disturbed
areas on the path and nearby undisturbed areas were surveyed for both species
along transects running perpendicular to a road. Norway maples were present
in greater number closer to the road and on the path, while the number of
sugar maples was not significantly associated with either the road or the path.
These results suggest that human-caused disturbances have a role in facili-
tating the establishment of an invasive species.

Key Words: invasive plants, Norway maple, Acer platanoides, sugar maple,
cer saccharum, disturbance

Biological invasions happen when non-native species are in-
troduced into new environments (Drake 1988). Although many
of these species are absorbed into the community without influ-
encing it very much (Begon et al. 1996), the detrimental effects
of some invasives have been recognized as one of the major
threats to biological diversity (Soule and Kohm 1989). These spe-
cies may alter population dynamics, community structure (Elton
1958; Mooney and Drake 1986), and ecosystem structure and
diversity (Vitousek 1990).

ile natural disturbances often increase species richness and
diversity (Hobbs and Hunneke 1992), they can also increase the
likelihood of invasion. The potential for invasion is enhanced
when a combination of disturbances is present (Hobbs 1991). For
this study, disturbance refers to events that stress the community
and influence resource availability and mortality rates. Examples
include soil exposure, edge effects, nutrient addition (Hobbs
1991), and any event that removes plants, leaving a space open
for colonization (Begon et al. 1996).

' Current address: Harvard Forest, P.O. Box 68, Petersham, MA 01366.
264

1999] Anderson—Invasion of Norway Maple 265

One common type of disturbance occurs when an edge of a
community faces a more open area, such as a field, path, road,
or body of water. An “edge effect’? occurs because the edges of
a forest have a different microclimate than the forest interior. This
results in a different plant species composition, including a higher
number of exotics, and different community structure. In North
Carolina, Fraver (1994) measured the percent cover of individual
species and the relative cover of exotic species, and found edge
effects extended 20-60 m into the interior of the forest. In ad-
dition, exotics were found mainly on the edges and did not make
up a significant portion of the forest interior. In Pennsylvania and
Delaware, the edge effect significantly influenced light, temper-
ature, litter moisture, humidity, and shrub cover up to 50 m from
the edge (Matlack 1993).

primary reason for the spread and 0 psotscg aca of invasive
species is their introduction by humans as crops, ornamentals, or
for forestry (Elton 1958). Norway maple (Acer as: bin)
is an ornamental that has been described as an invasive exotic in
urban forests in New Jersey (Webb and Kaunzinger 1993), Penn-
sylvania (Kloeppel and Abrams 1995), and Great Britain (Nowak
and Rowntree 1990). Norway maple is the widest ranging maple
in its native European habitat. Introduced into the United States
in 1756 by John Bartram of Philadelphia, its optimal range in the
United States includes coastal northern New England, southern
New England, and the Midwest (Nowak and Rowntree 1990). It
may be able to transform the native woodland by outcompeting
sugar maple (Acer saccharum Marshall; Webb and Kaunzinger
1993), which is native to the United States.

Norway maple and sugar maple grow side by side as street
trees and in urban forests and share many life-history character-
istics. Both species produce seeds in the fall that require 2-3
months of stratification before spring germination (Hartmann et
al. 1990) and both have been described as shade tolerant in their
native ranges (Diekmann 1996; Sipe and Bazzaz 1995). Sugar
maple grows best in small gaps (Runkle 1984). Although it grows
faster in a gap than in the closed canopy (Canham 1988), sugar

maple has a strong negative correlation with large gaps of 400m?
(Runkle 1984).

Norway maple has certain advantages that allow it to outcom-
pete sugar maple and influence species composition when it in-
vades urban woodlands. Since its introduction, Norway maple has

266 Rhodora [Vol. 101

become one of the most widely planted street trees due to its
longevity, disease resistance, and ability to withstand poor soils
and pollution. In urban areas, its wide tolerances and abundant
seeds allow it to colonize woodlots and urban forests (Spongberg
1990). Norway maple also has a physiological advantage over
sugar maple due to its higher rate of photosynthesis, longer re-
tention of leaves in the fall, and faster sapling growth (Kloeppel
and Abrams 1995). In addition, Norway maple can influence
community structure. In a New Jersey sugar maple/beech/oak for-
est that had been invaded by Norway maple, the understory spe-
cies richness for each of the canopy trees was compared. Norway
maple had a significantly lower species richness in its understory
than the other tree species (Wyckoff and Webb 1996).

se of this study was to determine if there is a cor-
relation between disturbance and the establishment of Norway
maple.

STUDY SITE

The Middlesex Fells Reservation in eastern Massachusetts was
created in 1894. European colonists, arriving in the area in the
1600s, used the land primarily for farming but also for mills,
firewood, cattle grazing, and mining (Levin and Mahlstedt 1990).
Today the Fells is a mostly wooded, popular urban retreat. Only
10 km north of Boston, it is located in the towns of Winchester,
Stoneham, Melrose, Malden, and Medford. Routes 23 and 93 run
through the middle of the Reservation and divide it into eastern
and western halves. Two-lane paved roads run along the perim-
eter, with Norway maples planted as street trees in some areas.
The trees range from 10-40 cm in diameter. No record could be
found of exactly when they were planted, but all are large enough
to produce seeds.

The western side of the Fells, where this study was done, cov-
ers about 400 ha. The landscape changes greatly over short dis-
tances, due to high ridges with exposed ledges that run north to
south with slopes running down to streams, ponds, and large man-
made reservoirs (Drayton and Primack 1996). Foot, animal, and
mountain bike traffic can be heavy on the extensive 3-5 m wide
Carriage roads and the smaller footpaths. The first major carriage
paths were likely due to the creation of the reservoirs from 1870—
1901. Later, in the 1930s, the Civilian Conservation Corps and

1999] Anderson—Invasion of Norway Maple 267

the Works Progress Administration also built many roads and
paths (Levin and Mahlstedt 1990).

MATERIALS AND METHODS

Twenty-four transects were established perpendicular to the paved
roads along the western side of the Middlesex Fells Reservation.
At each of twelve sites two parallel transects were set up, one
with a path as the transect line (disturbed), and another 20 m
away in an area with no path (undisturbed). Along each transect,
10 X 10 m plots were established with the first plot at the road.
On the transect that ran along the path, half of each plot was
placed on either side of the path. The next two plots leading away
from the road (numbers 2 and 3) had 50 m between them, with
100 m between remaining plots (Figure 1). Sampling was dis-
continued when the plots had no Norway maples, and a visual
inspection showed no more further on. In each plot, the number
of Norway and sugar maples above 50 cm in height was counted.

To determine the influence of the path, a Mann-Whitney test
was performed on the number of Norway maples and sugar ma-
ples on and off of the path. To determine the influence of the
road, a Mann-Whitney test was performed comparing the number
of Norway maples and sugar maples in plots 1 and 2. Plots 2
and 3 were also compared. Only the first three plots at each site,
both on and off the path, were used in the analysis due to the
lack of replication for plots 4—6. All statistical analysis was done
on SPSS (SPSS, Version 6.1, Chicago, Illinois).

RESULTS

The path and distance from the road (using plot as a proxy for
distance) correlated with the presence of Norway maples but not
the presence of sugar maples. Results of the Mann-Whitney tests
indicated there were significantly more Norway maples closer to
the road and on the path (Figure 2; path: df=65, Z=—2.538,
P=0.011; plot 1—plot 2: df=49, Z=—3.628, P<0.001; plot 2—plot
3: df=41, Z=—1.345, P=0.179). Results of the Mann-Whitney
tests indicated that the number of sugar maples was not affected
by the road or path (Figure 3; path: df=65, Z=—0.367, P=0.713;
plot 1—plot 2: df=49, Z=—0.504, P=0.614; plot 2—plot 3: df=41,
Z=—0.699, P=0.484).

268 Rhodora [Vol. 101

path

Figure 1. Representation of placement of transects and plots at the Mid-
dlesex Fells Reservation.

DISCUSSION

Two specific factors were hypothesized to aid Norway maple’s
invasion. First, that the road, planted with Norway maples as
street trees, created an edge effect and acted as a seed source.

1999] Anderson—Invasion of Norway Maple 269

Mean Number of Norway Maples

[7] path

/
Z non-path

number of trees

PLOT 1 PLOT 2

Figure 2. Mean number of Norway — in plots 1-3 at the Middlesex
Fells Reservation. Error bars indicate +1 SE

Second, that the paths running perpendicular to the road allowed
Norway maple to penetrate greater distances along the path than
in nearby nondisturbed areas with no paths.

As hypothesized, there were significantly more Norway maples
by the road and on the path (Figure 2). The effect of the road
seems not to have exceeded 50 m, as there was no significant
difference in the number of Norway maple trees in plots 2 and
3. It is possible that there were more Norway maples closer to
the road because there were abundant seeds from the nearby street
trees, and not due to Norway maple’s tolerance for salt or other
edge effects. Even if edge effects were not a significant factor,
the path seems to have acted as a place for Norway maple to
become established.

Since sugar maple abundance has been shown to have a sig-
nificant negative correlation with large gaps (Runkle 1984), its
abundance was expected to increase with distance from the road.
Contrary to expectations, the presence of sugar maples was not
significantly affected by the road or the path (Figure 3). The edge
effects may not have been strong enough to influence the sugar
maple.

These results suggest that Norway maple relies more on dis-
turbed habitats for establishment than sugar maple does. Invasive
plants can follow one of two patterns, either advancing in a front
or as scattered small populations (Baker 1986). Species that de-

270 Rhodora [Vol. 101

Mean Number of Sugar Maples

sa path

non-path

number of trees

PLOT 2 PLOT 3

3. Mean number of sugar maples in plots 1—3 at the Middlesex
Fells Reservation. Error bars indicate +1 SE.

pend on disturbance for successful invasion favor the second pat-
tern. These species also share many characteristics of early-suc-
cessional plants, such as high rates of population growth, pho-
tosynthesis, respiration, transpiration, and growth (Bazzaz 1986).
In this study, there were often large numbers of Norway maples
near the road, but they penetrated further into the forest with large
spaces in-between, not in a solid front. In comparison to sugar
maple (Kloeppel and Abrams 1995), Norway maple has many of
the characteristics listed by Bazzaz that would make it better
adapted than sugar maple to exploit disturbance.

Norway maple may be contributing to a proposed trend of
invasion by exotics and loss of native species in the Middlesex
Fells. A survey of species lost over one hundred years found three
trends: the number of native species declined, the number of ex-
otics increased in proportion to the total flora, and species were
most affected in moist habitats (Drayton and Primack 1996). This
suggests several effects Norway maple could have in the Fells.
For example, in this study, I observed that Norway maple invaded
furthest in low, moist areas, which may lead to its contributing
to any loss of native species in the moist areas. As Norway maple
also has a lower species diversity under its canopy than sugar
maple (Wyckoff and Webb 1996), this may also influence the
Middlesex Fells’ herbaceous layer in the moister areas.

As a common street tree, Norway maple has great invasive

1999] Anderson—Invasion of Norway Maple 271

potential. The likelihood of successful invasion depends on the
nature and extent of the disturbance, the number of exotic seeds
deposited each year, and how long the community is subject to
the propagules (Rejmanek 1989). Thus, communities near street-
planted Norway maples are at high risk of invasion. First, the
street is a large disturbance, producing an edge effect and intro-
ducing pollution and road salt into the community. Second, the
woodland is subjected to an annual deposition of seeds from ma-
ture Norway maple trees. Since Norway maple is widely planted,
many communities are exposed to its seeds. Where the habitat is
not conducive to invasion, the threat may not materialize, but
having it planted so widely increases the chance that a vulnerable
community will be nearby.

Since Norway maple is becoming established in the Fells, and
becoming the dominant tree near the road at many sites, it would
be worthwhile to investigate other species in the Fells that might
be influenced by Norway maples’ dense stands. It may be rea-
sonable to cut down the roadside trees that are the seed source,
replacing them with a native tree such as sugar maple. It is es-
pecially important to remove those trees in the Fells that are in
sensitive areas. These results also support restrictions on further
path construction for recreational purposes.

ACKNOWLEDGMENTS. This study was done as part of a Senior
Honors Thesis at Tufts University. I would like to thank my com-
mittee: Dr. George Ellmore, Dr. Sara Lewis, Dr. Colin Orians,
and Dr. Chris Swan. I appreciate Richard Anderson’s generosity
with the use of his computer and his statistical advice, and Jen-
nifer Kearsley teaching me field methods and giving advice in
the early planning of the project. I’m also grateful to three anon-
ymous reviewers for their comments.

LITERATURE CITED

Baker, H. G. 1986. Patterns of plant invasion in North America, pp. 43-57.
In: H. A. Mooney and J. A. Drake, eds., Ecology of Biological Invasions
of North America and Hawaii. Springer-Verlag, New York.

Bazzaz, FE. A. 1986. Life histories of colonizing gee Some A A
genetic, and physiological features, pp. 96—10 : H. A. Mooney and
J. A. Drake, eds., Ecology of Biological ac oe North America and
Hawaii. Springer-Verlag, New York.

212 Rhodora [Vol. 101

BEGON, M., J. L. HARPER, AND C. R. TOWNSEND. 1996. Ecology. Blackwell
Science Ltd., Cambridge, M

CaNHAM, C. D. 1988. Growth and Seeoy architecture of shade-tolerant trees:
Response to canop gaps. Ecology 69: 786-795.

DIEKMANN, M. 1996. Ecological behavior of deciduous hardwood trees in
Boreo-nemoral Sweden +4 relation to light and soil conditions. Forest
Ecol. Managem. 86:

Drake, J. A. 1988. Biologia invasions into nature reserves. Trends Ecol.
Evol. 3: 186-18

DRAYTON, B. AND ry B. PRIMACK. 1996. Plant species lost in an isolated
conservation area in metropolitan Boston from 1894 to 1993. Conser-
vation Biol. 10: 30-39.

oe _ = 1958. The Ecology of Invasions by Animals and Plants. Red-

Press Limited, London

Ee S. 1994. Vegetation responses — edge-to-interior gradients in the
mixed hardwood forests of the Roanoke River basin, North Carolina.
Conservation Biol. 8: 822-832.

HARTMANN, H. T., D. E. KESTER, AND E T. Davies, Jr. 1990. Plant Propa-

Hosss, R. J. 1991. Disturbance a precursor to weed invasion in native veg-
etation. Pl. Protect. Quart. 6: 99-104.

: HUENNEKE. 1992. Disturbance, diversity, and invasion: Im-
slicatisee for big h ge ihe Biol. 6: 324-337.

KLOEpPEL, B. D. AND M. D. ABRAMs. 1995. Ecophysiological attributes of the
native Acer nai and ae exotic Acer platanoides in urban oak
forests in persion. USA. Tree ime 15: 739-746.

LEVIN, E. AND T. MAHLSTEDT. 1990. Middlesex Fells Reservation Historic
Land-use Study. Metropolitan District cost Reservations and
Historical Sites Division, Boston, MA.

MatTLack, G. R. 1993. Microenvironment variation within and among forest
edge sites in Lepeve United States. Biol. Conservation 66: 185-194.
Mooney, H. A. and J. A. DRAKE, eds. 1986. Ecology of Biological Invasions

of North pate and Hawaii. Springer-Verlag, New
Nowak, D. J. AND R. A. ROWNTREE. 1990. Hist story and range of Norway
291-296.

maple
REJMANEK, M. 1989. tap of plant communities, a 369-388. In: J.
ake, H. A. Mooney, F di Castri, R. H. Gro s, E J. Kruger, M.
Rejmanek, and M. Williamson, eds., Biological lavciiie A Global Per-
spective. John Wiley and Sons, New Yor
RUNKLE, J. R. 1984. Development of wand Rebctsiin in treefall gaps in a
beech-sugar maple forest. Holarc. Ecol. 7: 157-164.
Sipe, T. W. AND E A. Bazzaz. 1995. Gap partitioning among maples (Acer)
in central diy England: Survival and growth. Ecology 76: 1587~—1602.
- AND K. A. Kou. nites Research Priorities for Conservation
Diclows tsdend Press, Washin
ease: S. A. 1990.
bri

A Reunion at Trees. Harvard University Press, Cam-

hii P M. 1990. Biological invasions and ecosystem processes: To-

1999] Anderson—Invasion of Norway Maple 273

wards an integration of population biology and ecosystem studies. Oikos
57: 7-13.

WEBB, S. a AND C. K. KAUNZINGER. 1993. Biological invasion of the Drew
University (New ri forest preserve by Norway maple. Bull. Torrey
Bok? Club 120: 343-—

Wyckorr, P. H. anp S. cas B. 1996. Understory influence of the invasive
Norway maple (Acer platanoides). Bull. Torrey Bot. Club 123: 197-205.

RHODORA, Vol. 101, No. 907, pp. 274-276, 1999

CARDAMINE GEORGIANA (BRASSICACEAE), A NEW
NAME REPLACING DENTARIA MICROPHYLLA

IHSAN A. AL-SHEHBAZ
Missouri Botanical Garden, PO. Box 299, St. Louis, MO 63166-0299

SUZANNE I. WARWICK

Eastern Cereal and Oilseed Research Centre, Agriculture and Agri-Food
Canada, Central Experimental Farm, Ottawa, Ontario KIA 0C6, Canada

ABSTRACT. Cardamine georgiana is proposed to replace the illegitimate
name C. microphylla (Willd.) O. E. Schulz (1903; non Adams 1817). A dis-
cussion on the generic limit of Cardamine including Dentaria is presented.

Key Words: Cardamine, Dentaria, Georgia

Both Cardamine and Dentaria were simultaneously published
by Linnaeus (1753). When uniting the two genera, Crantz (1769)
adopted Cardamine for the combined genus and, therefore, this
name has priority (Greuter et al. 1994; Article 11.5 ex. 14). Al-
though in most treatments (Akeroyd and Marhold 1993; Al-Sheh-
baz 1988; Cullen 1965; Rollins 1993; Schulz 1903, 1936) Den-
taria is reduced to a synonym of Cardamine, some North Amer-
ican authors (Detling 1936; Harriman 1965: Turrill et al. 1994)
and eastern European authors (Busch 1909, 1939; Czerepanov
1995; Grossheim 1950; Khintibidze 1979) maintain it as a distinct
genus.

The alleged morphological differences between Dentaria (larg-
er flowers, fleshier and larger rhizomes, often petiolate cotyle-
dons, and stems narrowest at base) and Cardamine (usually small-
er flowers, often nonfleshy and smaller rhizomes, usually sessile
cotyledons, and stems usually broadest at base) Clearly do not
hold if the two genera are examined on a worldwide basis (Al-
Shehbaz 1988). As indicated by Franzke et al. (1998) and Swee-
ney and Price (pers. comm.), molecular data clearly show that
Dentaria is polyphyletic and is nested within Cardamine.

ing the process of compiling a worldwide checklist of chro-
mosome numbers of the Brassicaceae (Cruciferae), it became ev-
ident that the transfer by Schulz (1903) of Dentaria microphylla
Willd. to Cardamine created a later homonym of C. microphylla

274

1999] Al-Shehbaz and Warwick—Cardamine georgiana 275

Adams and two other homonyms (see below). Therefore, C. geor-
giana is proposed as a nom. nov. to replace the illegitimate name.

Dentaria microphylla which is narrowly endemic to Georgia
and adjacent easternmost Turkey, was recognized in Dentaria by
Busch (1909, 1939), Czerepanov (1995), Grossheim (1950), and
Khintibidze (1979) under this correct name. It was treated in Car-
damine by Cullen (1965), Kolakovsky (1982), and Schulz (1903)
under the illegitimate later homonym C. microphylla (Willd.) O.
E. Schulz. By contrast, the earlier homonym C. microphylla Ad-
ams is a species distributed in northwestern Alaska, the Russian
Far East, and eastern Siberia (Berkutenko 1988; Czerepanov
1995; Khatri 1990; Rollins 1993).

Cardamine georgiana Al-Shehbaz & Warwick, nom. nov. Re-
placed name: Dentaria microphylla Willdenow, Sp. Pl. 3:
479. 1800. Syn. Cardamine microphylla (Willd.) O. E.
Schulz, Bot. Jahrb. Syst. 32: 342. 1903, not C. microphylla
Adams, Mém. Soc. Imp. Naturalistes Moscou 5: 111. 1817,
not C. microphylla J. Presi, Delic. Prag. 1: 15, 1822. TYPE:
[GEorGIA]. Collector and locality unknown (HOLOTYPE: B not
seen).

ACKNOWLEDGMENT. We thank Michael G. Gilbert for his crit-
ical review of the manuscript.

LITERATURE CITED

AKEROYD, J. R. AND K. Maruo_p. 1993. Cardamine, pp. 346-351. In: T. G.
tin et al., eds., Flora Europaea, Vol. 1, 2nd ed. Cambridge Univ. Press,

Cambridge, Englan

AL-SHEHBAZ, I. A. 1988. The genera of Arabideae (Cruciferae; Brassicaceae)
in the southeastern United States. J. Arnold Arbor. 69: 85-166

BERKUTENKO, A. N. 1988. Brassicaceae, pp. 38-115. In: S. S. Charkevicz,
ed., Plantae Vascular Orientis Extremi Sovietici, Vol. 3. Academy of
Sciences, Lenin

Buscu, N. 1909. inca pp. 356-370. In: N. Kusnezow, N. Busch, and A.
Fomin, eds., Flora Caucasica Critica, Vol. 3(4). Typographie K. Matte-
cena, Urev

- L9So: Dentiria, pp. 144-153. In: V. L. Komarov, ed., Flora of the
USSR, Vol. 8. Academy of Sciences of USSR, Moscow & Leningrad.

Crantz, H. J. N. 1769. Classis Cruciformium Emendata. Leipzig.

CULLEN, J. 1965. Cardamine, pp. 438-444. In: P. H. Davis, ed., Flora Turkey,
Vol. 1. Edinburgh Univ. Press, Edinburgh.

276 Rhodora [Vol. 101

CZEREPANOV, S. K. 1995. Vascular Plants of Russia and Adjacent States (the
Former USSR). Cambridge Univ. Press, Cambridge, Englan

eekartee L. E. 1936. The genus Dentaria in the Pacific States. yy tin J. Bot.

70-576.

FRANZKE, A., K. POLLMAN, W. BLEEKER, R. KOHORT, AND H. HurKa. 1998.
Molecular systematics of Cardamine and allied genera (Brassicaceae):
ITS and non-coding — DNA. Folia Geobot. 33: 225-240.

GreuTer, W., FE R. Barrie, H. M. BurDET, W. G. CHALONER, V. DEMOULIN,

T :
menclature (Tokyo Code). Koeltz Scientific Books, Kénigstein y.
GrossHEIM, A. A. 1950. Flora Kavkaza, 2nd ed. Academy of Sciences of
SSR, Moscow & Leningrad.
HARRIMAN, N. A. 1965. The genus Dentaria j (Cruciferae) i in eastern North

Sl.
wis A. A. 1982. Flora Abkhazia, Vol. 2, 2nd ed. Metsniebera, Tbi-

panes C. 1753. Species Plantarum, Vol. 2. The Ray Society, London.
ROLLINS, R. C. 1993. Cruciferae of Continental North America. Stanford
Univ. Press, Stanford.

ScHUuLz, O. E. 1903. Monographie der Gattung Cardamine. Bot. Jahrb. Syst.
32: 280-623.

- 1936. Cruciferae, pp. 227-658. In: A. Engler and H. Harms, eds.,
Nat, ce 17b, 2nd ed. W. Englemann, Leipzig.

TURRILL, N. L., . EVANS, AND G. S. GILLIAM. 1994, fdeaenictlite of West
Virginia sears of the Dentaria complex (D. diphyllu Michx., D. het-
erophylla Nutt., and D. laciniata Muhl. ex Willd. oe using
above-ground vegetative characters. Castanea 59: 22-30.

RHODORA, Vol. 101, No. 907, pp. 277-297, 1999

COVARIANCE OF LICHEN AND VASCULAR
PLANT FLORAS

JAMES P. BENNETT
Biological Resources Division, U. S$. Geological Survey, Institute for
Environmental Studies, University of Wisconsin, 504 Walnut St.,
Madison, WI 53705

CLIFFORD M. WETMORE

Department of Plant Biology, University of Minnesota, 1445 Gortner Ave.,
St. Paul, MN 55108

ABSTRACT. The € geographic oe among taxonomic groups are im-

Lakes parks, between 28-30% of either the vascular plant or lichen species
were singletons (occurring in only one park), but the parks that contained the

fekens species (2%) than vascular plants (4%) occurred in
Latitude appeared to explain some of the variation between the two groups:
vascular plants decreased with increasing latitude, while lichens increased.

Key Words: floras, lichens, vascular plants, species-area curves

The number of lichen species in North America, north of Mex-
ico, is thought to be approximately 3600 (Esslinger and Egan
1995), while the number of vascular plant species approaches
22,000 (Kartesz 1994), a ratio of about six vascular plant species
to one lichen species. Although general, ratios like this have been
used to make broad biodiversity estimates (e.g., Hawksworth
1991). Such estimates can be made more useful if the geographic
pattern of covariance of higher taxa can be ascertained. In recent
years studies of spatial covariance of higher taxa have been con-
ducted in order to determine patterns of biodiversity hotspots, or

ail

278 Rhodora [Vol. 101

the relationships among taxa, if any exist (Faith and Walker 1996;
Gaston 1996). Many factors can affect spatial covariance, includ-
ing scale, environmental factors, and biological properties of the
taxa. Several authors have pointed out that lichen and vascular
plant diversities may not track each other in general due to cli-
mate (Huston 1994) and habitat diversity (Galloway 1992; Gilbert
1977). Another study found that lichen biodiversity decreased
significantly with an increase in vascular plant cover (Pharo and
Beattie 1997). In addition, we suspected that the effects of air
pollutants may also be a factor affecting lichen and vascular plant
floras differentially because of the greater air pollution sensitiv-
ities of lichens. This paper explores all of these issues using the
lichen and vascular plant floras of nine national parks in the Great
Lakes region of the United States.

The lichen floras of nine national parks in the Great Lakes
region of the north central United States have been well studied
in recent years and are considered to be fairly complete. The
parks include Apostle Islands National Lakeshore in Wisconsin
(APIS), Cuyahoga Valley National Recreation Area in Ohio
(CUVA), Grand Portage National Monument in Minnesota
(GRPO), Indiana Dunes National Lakeshore in Indiana (INDU),
Isle Royale National Park (ISRO) and Pictured Rocks National
Lakeshore in Michigan (PIRO), St. Croix National Scenic River
in Minnesota and Wisconsin (SACN), Sleeping Bear Dunes Na-
tional Lakeshore in Michigan (SLBE), and Voyageurs National
Park in Minnesota (VOYA; Figure 1). It is logical to study these
floras because they should show affinities with one another, being
associated geographically within the homogeneous Great Lakes/
north central U. S. region. The nine parks span a region of about
1200 km longitudinally, and in the aggregate, cover a total area
of 201,000 km?. The vascular plant floras of these parks have
been studied and were segregated into two groups by multivariate
analyses (Bennett 1996a, 1996b). This study was also undertaken
to determine if the same groups of parks are segregated based on
the lichen floras.

The management of natural area preserves is sometimes fo-
cused on a select group of organisms, e.g., mammals, trees, rare
plants, birds, or butterflies. It is often implicit in the management
of these groups that the management of one group will also sat-
isfactorily manage another group by association. This is because
it is assumed that the biological groups in an area are related. For

1999] Bennett and Wetmore—Covariance of Floras 279

Figure 1. Map of nine Great Lakes national park units for which floras
were used in this study. Park codes are explained in the introduction.

the purposes of this study, it was assumed that vascular plants
and lichens are related floristically somehow, although ecologi-
cally they occupy habitats at very different scales and their flo-
ristic relationships may be obscure. From a management per-
spective however, it may be assumed that if there are more vas-
cular plants in an area there will also be more lichens. This study
was undertaken in order to determine the validity of this as-
sumption by attempting to prove the hypothesis that there is no
relationship between vascular plant and lichen floras.

MATERIALS AND METHODS

Lichen floristic field work in the nine parks was conducted
during the summer in the years from 1978 to 1995, although
collecting was not done in these particular parks every year (Wet-

280 Rhodora [Vol. 101

a . Numbers of collections, collecting days, and collection localities
for lichens in nine Great Lakes national parks. See introduction for park
names.

Number of

Collecting Collection

Park Collections Days Localities
APIS 1497 21 28
CUVA 3 11 31
GRPO 373 3 6
INDU 371 14 24
ISRO 5246 53 2
PIRO 1231 11 25
SACN 2327 88 77
SLBE 847 10 27
VOYA 8028 80 128

park were selected to include all habitats and vegetation types.
The collection localities were distributed over the entire park, and
vegetation types were studied multiple times. At each locality, all
groups of lichens were collected (fruticose, foliose, squamulose,
and crustose) and sufficient time was spent examining all sub-
strates. At each locality all species found were collected to pro-
vide relative abundance estimates, even though the same species
might have been found at previous localities. A summary of the
collecting efforts is shown in Table 1. Vascular plant floras and
methods were described previously (Bennett 1996a).

The nomenclature of each lichen flora was updated to the fifth
checklist (Egan 1987) so as to standardize all the names. The
names were then entered into a computer spreadsheet program
(MICROSOFT EXCEL, Microsoft Corp., Seattle, WA) and the
presence/absence of each species recorded in a field for each park.

arious tallies and sorts were performed in order to perform qual-
ity control procedures and to rank species by frequencies. This
file was also used to analyze the data Statistically, using MINI-
TAB (Minitab, State College, PA) and SYSTAT (SPSS, Chicago,
IL). Relationships between variables were tested with Pearson’s
linear correlation coefficients.

Similarities between park floras were calculated using Jaccard’s

1999] Bennett and Wetmore—Covariance of Floras 281

Table 2. Area, numbers of lichen and vascular plant apace average Jac-
card similarity based on lichens and vascular plants, and average distance
from the other parks for nine Great Lakes national parks. See introduction
for park names

erat eee of Average Similarity

(decimal ee Vascular Average

Area degrees Vascular Lichen Plant Distance
Park (km?) N) Lichen Plant (%) (%) (km)
APIS 6605 47.000 285 509 39 35 388
CUVA 3136. =“ 4 4-283 66 855 18 26 842
GRPO 287 47.967 182 279 30 23 383
INDU 5203 41.625 62 1399 19 28 638
ISRO 54,140 48.000 554 698 31 OT 400
PIRO 25,545 46.567 245 123 36 39 415
SACN 26,459 46.000 282 1165 34 33 443
SLBE 23,663 44.875 182 928 33 oT 426
VOYA 55,955 48.500 458 603 35 35 566

similarity index, which measures the proportion of park pairs
where species are present in both parks in the pair. Details are
given in Bennett (1996b). The correlation of two similarity ma-
trices was tested with Mantel’s test with PC-ORD (McCune and
Mefford 1997).

Park distances and latitudes were measured using STREET AT-
LAS (De Lorme, Freeport, ME), a desktop computer mapping
program. Straight line distances and latitudes were calculated us-
ing the approximate park centroids for park locations. Distances
were rounded to the nearest five kilometers.

RESULTS

A floristic summary of each park is shown in Table 2. Isle
Royale had the greatest number of lichen species, while Indiana
Dunes had the lowest. The greatest and lowest numbers of vas-
cular plant species, however, were at Indiana Dunes and Grand
Portage, respectively. Based on the lichen floras, seven of the
parks were, on average, between 30 and 40% similar to all the
other parks, except for Indiana Dunes and Cuyahoga Valley,
which were almost 20% similar to all other parks. This is not too
surprising, given that on average they are farther away from all
the other parks. Overall similarity based on vascular plant floras

282 Rhodora [Vol. 101

followed the same pattern, except for Grand Portage, which had
the lowest overall similarity, lower than Cuyahoga Valley and
Indiana Dunes.

Some of the variables were significantly correlated (Table 3):
lichen numbers and park area (Figure 2), and average lichen sim-
ilarity and average distance (Figure 3) or latitude were the stron-
gest relationships. Number of lichens increased with latitude,
while vascular plant numbers decreased (Figure 4). Numbers of
lichens and vascular plants appeared to be negatively correlated,
but the probability of the correlation occurring by chance was
high (0.33). Park similarities based on lichens and vascular plants
were comparable (P = 0.0517). Vascular plant similarity signif-
icantly increased with area and did not appear related to latitude,
while park lichen similarity increased with latitude and was not
related to area.

The lichen flora Jaccard similarity matrix for all possible 36
pairs of the nine parks is shown in Table 4. Two park pairs, Isle
Royale and Voyageurs, and Apostle Islands and Pictured Rocks
were greater than 50% similar, while the overall average was
31%. The comparable distance matrix (Table 5) shows that Cuy-
ahoga Valley and Voyageurs are just over 1200 km apart, while
Grand Portage and Isle Royale are the closest pair at only 60 km
apart. The similarities for these same pairs were 11% and 30%,
respectively (Table 4). When all 36 pairs of similarities and dis-
tances were plotted against each other (Figure 5), there was a
clear negative relationship, even though the maxima and minima
did not all correspond.

The overall average of vascular plant similarities was 32% (see
Table 1 in Bennett 1996b), and only one park pair, Isle Royale
and Pictured Rocks, was more than 50% similar. The similarities
of Cuyahoga Valley and Voyageurs, and Grand Portage and Isle
Royale were 23% and 30%, respectively. The overall vascular
plant similarity matrix was significantly positively related to the
lichen similarity matrix (Mantel r = 0.9151, t = 6.3718, P =
0.0000), suggesting that these parks show comparable degrees
and patterns of similarity based on both vascular plant and lichen

oras.

A cluster analysis of the lichen flora Jaccard similarity matrix
did not reveal any significant groupings because the similarities
were not very diverse. However, a cluster analysis of the pres-
ence/absence matrix of all species in the nine parks did reveal

ble 3. Pearson’s linear correlation wapaie ator for variables given in a 2. Significance levels of coefficients are indicated

Ta
by preceding asterisks: * (0.05), ** (0.01), and *

* (0.001). ' Number of speci
Average
Vascular Average Lichen Vascular Plant

Area Latitude Lichens' Plants! Similarit Similarity
Latitu ,
Lichens' ***0.9124 **().7968
Vascular plan —0.1671 *—0.6985 —0.3715
Average vee similarity 0.5214 **0.8379 0.6210 —0.4850
Average vascular plant

similarity *0.7054 0.3882 0.5783 0.0440 6628

Average distance —0.2143 *—0.7685 —0.4796 0.4002 **—(0.8083 —0.4540

[6661

selOLJ JO duRLRAOD—oI0UNE AM pur youUDg

€87

284 Rhodora [Vol. 101

500 Lichens = 0.7817 area + 54.262

s R? = 0.8325 :
3 400 ‘
®
> 300 |
2 200 |
=
2 100 |

0 ' T T T T

0 > 200 S00 400. 500. 800

Area (km?)

Figure 2. Relationship between number of lichen species and area for
nine Great Lakes national parks, and fitted linear regression line.

some interesting groups (Figure 6). At the highest similarity level,
abo %, four parks (Apostle Islands and Pictured Rocks, and
Cuyahoga Valley and Indiana Dunes) were grouped into two pairs
that were themselves only about 36% similar. Cuyahoga Valley
and Indiana Dunes appeared to be two parks that were unrelated
floristically to the other seven, which appeared to be about 50%
similar overall. Isle Royale, however, was less similar to the other
six northern parks, in spite of the high individual Jaccard simi-
larity with Voyageurs. Two groups of three parks each had sim-

Average lichen similarity
oO
nN

0.1 4 Similarity = -0.0004 distance + 0.4997
R 6

300 400 500 600 700 800 900
Average distance (km)
Figure 3. Relationship between average lichen flora similarity and aver-

age distance from the other parks for the nine Great Lakes national parks,
and fitted linear regression line.

1999] Bennett and Wetmore—Covariance of Floras 285

1600
1400 - “‘ Vascular plants = -88.418 degrees + 4841
R? = 0.4878

Lichens = 48.801 degrees - 1975
R? = 0.635 8

Number of species
co
So
So

40 41 42 43 as 45 46 47 48 49
Latitude (degrees North)

@Lichens 4 Vascular plants

Figure 4. Relationships between number of vascular plant and lichen spe-
cies and latitude for nine Great Lakes national parks, and fitted linear re-
gression lines.

ilarities of 60-70%. One of these had two parks on the southern
shore of Lake Superior and one at the northern end of Lake Mi-
chigan (Apostle Islands, Pictured Rocks, and Sleeping Bear
Dunes), and the other consisted of three Minnesota parks (Grand
Portage, Voyageurs, and St. Croix).

Totals of 698 lichen species in 162 genera were found in the
nine parks when the floras were aggregated. The most frequent
species, i.e., those that were found in all nine parks (14 species,
or 2% of all lichen species found), included Arthonia caesia,
Candelariella efflorescens, Cladina rangiferina, Cladonia chlo-

Table 4. Jaccard similarity (%) matrix for lichen floras of nine national
parks.

APIS CUVA GRPO INDU ISRO PIRO SACN SLBE

PIRO bof BS 13.1 40.9 i) see

SACN 43.5 20.0 33.7 19.0 364 P

SLBE 42.8 20.4 31.9 pa 8 4.7 39.8

VOYA 49.8 11.0 35.6 11.1 59.1 41.7 457 30.6

286 Rhodora [Vol. 101

Table 5. Distance matrix for nine national parks. Distances are in kilo-
meters between park centroids.

APIS CUVA GRPO INDU ISRO PIRO SACN SLBE

CUVA 950
GRPO 145 975
U 670 470 = 745
ISRO 185 930 725
PIRO 340 690 MO.2400 862
SACN 125 980: 275 620 320 435
SLBE 425 ao0-=2 7900 390 §=6410 185 480
VOYA 260 1210 260 Jae -320ic | 560 = 310 685

rophaea, C. coniocraea, C. cristatella, Flavoparmelia caperata,
Lepraria finkii, Melanelia subaurifera, Parmelia sulcata, Phaeo-
physica pusilloides, Physconia detersa, Punctelia rudecta, and
Scoliciosporum chlorococcum. Thirty percent of lichens (210 spe-
cies) occurred in only one park. Most of these (129) occurred in
Isle Royale. For the vascular plants, an aggregated flora of 2102
species in 691 genera was found over all the parks, with 81 (4%)
occurring in all nine parks. Twenty-eight percent of the vascular

0.70
0.60 - e, Vascular plants = -0.0002 distance + 0.4251
0.50 - . R? = 0.2612
= 0.40 | : :
E 0.30 }os
0.20 “ - =
0.10 Lichens = -0.0004 distance cia 4 -
0.00 +———S=agee Cd
0 500 1000 1500
Average distance (km)

4 Vascular plants @ Lichens

Figure 5. Relationships of vascular plant and lichen flora similarities to
distance between parks for each of the 36 possible park pairs of the nine
Great Lakes national parks, and fitted regression lines.

1999] Bennett and Wetmore—Covariance of Floras 287

Similarity (%)
.

1 00 + T !
& . & oO N)
6 fe er le le

Parks

e 6. Cluster dendrogram for nine Great Lakes national lichen
higel using Ward’s linkage and correlation for the distance meas

plants (596 species) occurred in just one park each. Most of these
(221) were found in Indiana Dunes.

DISCUSSION

At first glance it appears that for this set of nine park floras
there was no obvious relationship between vascular plants and
lichens. However, further examination of the parks sheds more
light on the problem. Two parks, Cuyahoga Valley and Indiana
Dunes, are in locations that have been subject to oxidant and
sulfur oxide pollution fumigations for many years, and studies
have shown that the lichen floras of these parks have decreased
to about 80% of their historical floras (Wetmore 1988a, 1989).
However, if these two parks were to be omitted from the analysis
there would not be enough data points to draw justifiable conclu-
sions about the vascular plant/lichen relationship. When the his-
torical total numbers of species were used instead of current spe-
cies numbers (205 for Cuyahoga Valley and 154 for Indiana
Dunes), there was still no clear relationship. This appears due to
the vascular plant flora numbers rather than the lichen flora num-
bers. The vascular plant flora numbers were not linearly related
to area (Table 3). This is probably due to confounding effects of

288 Rhodora [Vol. 101

Lichens = 1.0261 Vascular plant

Lichens

100 1,000 10,000 100,000 1,000,000
Vascular plants

Figure 7. Relationship between numbers of lichen and vascular plant spe-
cies for 33 areas, and fitted non-linear regression line.

latitude, as vascular plant diversity decreases with increasing lat-
itude, the opposite of what happens with the lichen diversity
(Huston 1994).

Do lichen and vascular plant floras co-vary? At the scale of
the Great Lakes no relationship could be seen, but what about at
other scales? The flora data for the nine parks were combined
with comparable data for 24 other geographic areas, including the
world, and are shown in Figure 7 (Table 6). It appears that when
larger geographic areas were included, a significant, positive re-
lationship was found between the two floras (r = 0.9808), even
when the floras of the world were omitted (r = 0.7037). When
only areas less than 1000 km? were considered, the relationship
broke down (r = 0.0896). Area was obviously a factor when all
33 areas were considered (Figure 8), but may not have been with
areas under 1000 km? for the reasons given above. This finding
differs significantly from an older study of lichens and area where
no relationship was found above 1000 km? (Wetmore 1967),
which was based on incomplete inventories.

We conclude that any relationship between vascular plant and
lichen floras is scale-dependent. For natural areas under approx-
imately 1000 km?, no relationship was found for the national

Table 6. Areas, numbers of vascular plant (VP) and lichen (L) species, and the ratio of the two (VP/L), for 33 locations.

Vascular Reference and
Location (km?) Plants Lichens VP/L Comment
Homestead National Monument, NE 1 2er 19 TE.9S Bennett 1996a;
Wetmore an
Bennett 1997
George Washington Carver National Monument, 1 605 38 15.92 Bennett 1996a;
MO Wetmore 1992a
Pipestone National Monument, MN 1 439 66 6.65 Bennett 1996a;
Wilson and Vinyard
1
Grand Portage National Monument, MN 3 279 182 1,53 Be 19
Wetmore 1992b
Effigy Mounds National Monument, IA 6 458 73 5.80 Bennett 1996a;
Wetmore and
Bennett 1997
Wilson’s Creek National Battlefield, MO i) 454 88 5.16 Bennett 1996a;
Wetmore and
Bennett 1997
Tuxedni Wilderness, AK 23 290 214 1.36 Talbot et al. 1995;
Talbot et al. 1992
Indiana Dunes National Lakeshore, IN 52 1399 62 22.56 Bennett 1996a;
Wetmore 1988a
Apostle Islands National Lakeshore, WI 66 509 285 1.79 Bennett 1996a;
Wetmore 1990a
Cuyahoga Valley National Recreation Area, OH 131 855 66 12.95 Bennett 1996a;

Wetmore 1989

[6661

SPIO, JO DOURLIEAOD—sIOUTIZ AA pue WoUuUUg

Table 6. Continued.
Area Vascular Reference and
Location (km?) Plants Lichens VP/L Comment
Nantucket Island, MA 140 939 99 9.48 Dunwiddie and
Sorrie 1996 (species
not seen after 1960
tted)
Acadia National Park, ME 190 858 397 2.16 cis 1997b;
Wetmore 1984
Sleeping Bear Dunes National Lakeshore, MI 237 928 182 5.10 Bennett 1996a;
Wetmore 1988b
Pictured Rocks National Lakeshore, MI 255 723 245 2.95 Bennett 1996a;
Wetmore 1990b
St. Croix National Scenic Riverway, MN and WI 265 1165 282 4.13 Bennett 1996a;
Wetmore 1991
Theodore Roosevelt National Park, ND 285 550 212 2:09 Anonymous 1997b;
Wetmore 1983a
Chiricahua National Monument, AZ 485 672 200 3.36 Anonymous 1997b;
Wetmore and
Bennett 1992
(Lichen number is
doubled because
flora is 50% known.)
Isle Royale National Park, MI 541 698 554 1.26 Bennett 1996a;
Wetmore 1985
560 603 458 1-32 Bennett 1996a

Voyageurs National Park, MN

Wetmore 1983b

067

elopoyy

101 ‘I°A]

Table 6. Continued.

Area Vascul Reference and
Location (km?) Plants Lichens VP/L Comment
Glacier National Park, MT 4,102 1147 425 2.70 Anonymous 1997b; Debolt
and McCune 1993
Yellowstone National Park, WY 8,983 1150 236 4.87 Anonymous 1997b;
Eversman 1990
Israel 21,946 2250 229 9.83 Zohary 1962;
Kondratyuk et al.
1996
Netherlands 41,784 1781 633 2.81 Statistics Netherlands
97; B. Wit, pers.
comm.
Tasmania 67,858 1456 655 2.22 Chapman 1997;
Galloway 1992
United Kingdom 229,979 2397 1,730 1.39 Palmer 1996;
Galloway 1992
New Zealand 268,114 4167 1,162 3.59 Allan 1961; Moore
and Edgar 1970;
Healy and Edgar
1980; Webb et al.
1988; Galloway 1985
Finland 338,148 2423 1,420 Bvt Anonymous 1997a; O. Vit-

Kainen, pers.
comm. 1997

[6661

SvIO]J JO 90URLIeAOD—aIOUT]IO AA pue WouUEg

167

Table 6. Continued.

Area Vascular Reference and
Location (km?) Plants Lichens VP/L Comment
California 411,049 5862 1,000 5.86 Hickman 1993;
Tucker and Jordan
9
British Columbia 948,600 2850 1,600 1.78 British Columbia
Ministry of
Environment, Land,
and Parks 199
Australia 7,682,341 14,679 2,499 5.87 Chapman 1997;
Galloway 1992
China 9,596,961 30,000 1,274 23:55 Harvard University
Herbaria 1997; Wei
1991
United States and Canada 21,479,211 21,757 3,600 6.04 Kartesz 1994;
Esslinger and Egan
1995
World 149,702,000 243,893 17,000 14.35 Mabberley 1987;

Thorne 1992;
Galloway 1992

C6T

eIOpouYy

TOT TOA]

1999] Bennett and Wetmore—Covariance of Floras 293

1,000,

A
100,000 ;
3 0.2542'
R? = 0.8074. 4A
A —
2 ns @
oe nm ee
Le
z 000 ont ae noma “a a Se crys Out
2 a, my \ ei a4 cr eee
ae ts oe
= ei Lichens = 50.827 area?*P
‘eee ee R? = 0.8453
. 1 1
e
10 : u
16-01 16400 1.6401 1.6402 1.6403 16+04 1.6405 1.6406 1.6407 1.6408 1.E+09
Area (km’)

Figure 8. Relationships between numbers of lichen and vascular plant
species and area for 33 areas, and fitted non-linear regression lines.

parks and areas in this study. This is partly due to the confound-
ing effect of latitude, which affects vascular plant and lichen rich-
ness in opposite ways. A second reason is that we deliberately
chose a set of natural areas in a relatively homogeneous ecolog-
ical region so as not to introduce significant habitat diversity. The
third reason is that vascular plants and lichens occupy microhab-
itats that are unrelated because of the scale differences between
the two groups of plants. Lichens occupy habitats at the centi-
meter scale, while vascular plants could be said to occupy habitats
at the meter scale. In addition, lichens can grow in some micro-
habitats where vascular plants are not found, e.g., house roofs or
rocks. However, when the range of natural areas was expanded
to include those larger than 1000 km’, a relationship between
vascular plant and lichen floras was found. This is most likely
due to the effect area has on increasing ecosystem diversity,
which produces more overall habitat diversity and hence species
diversity.

The similarity clusters of the parks based on the two types of
floras were not completely congruent. Both separated Indiana
Dunes and Cuyahoga Valley from the other seven parks, although
St. Croix was grouped with them for the vascular plants. This
separation of Cuyahoga Valley and Indiana Dunes is probably

294 Rhodora [Vol. 101

related to geographic distance, but may also be confounded by
the profound effects of air pollutants on the lichen floras. In the
remaining seven parks, Isle Royale appeared rather unique for
lichens in this region, but not for vascular plants. In fact, for
vascular plants, very little splitting of the cluster of seven was
apparent (Bennett 1996b). Lichen floras in this area appeared to
be more unique geographically than vascular plant floras, prob-
ably due to the diversity of species in the Great Lakes, not the
distribution of species per se.

The ratio of six vascular plant species to one lichen species for
North America appears to hold on average for the 33 areas as
well (Table 6): the overall average ratio for these areas was 6.20
(SD = 5.89). The ratio found for the world floras, however, was
an exception: it was over double the average ratio for North
America. No logical explanation can be proposed at this time for
this anomaly

In conclusion, although average similarities of these nine parks,
based on vascular plants and lichens, were comparable (just over
30%), this generalization hides the fact that the two types of floras
do not appear related to one another at this scale. There was a
closer relationship among the vascular plant floras than among
the lichen floras, suggesting that geographic affinities between

em are weaker for lichens. Thus, management strategies to con-
serve the vascular plant floras may not conserve the lichen floras
on an equal basis. Lichen biodiversity may have to be managed
differently than vascular plant biodiversity.

ACKNOWLEDGMENTS. Funding for the lichen field work de-
scribed in this study came from the Midwestern Regional Office,
National Park Service, Omaha, Nebraska, and the Biological Re-
sources Division, U. S. Geological Survey, Madison, Wisconsin,
and is gratefully acknowledged.

LITERATURE CITED

ALLAN, H. H. 1961. cio of New Zealand, Vol. 1. Government Printer, Wel-
lington, New Zeal
ANONYMOUS. 1997a. kes of the Vascular Plants of Finland. Internet
URL: www.helsinki.fi/kmus/chklst.html.
1997b. Flora and fauna of the national parks. Internet URL: endeav-
edu/NPS.

our. lee ucdavis.

1999] Bennett and Wetmore—Covariance of Floras 295

BENNETT, J. P. 1996a. Floristic summary of 22 national parks in the mid-
western United States. Nat. Areas J. 16: 295-302.

. 1996b. Similarities and life cycle distributions of floras of 22 national
parks in the midwestern United States. Nat. Areas J. 16: 303-309.

. 1997. Nested taxa-area curves for eastern United States floras. Rho-
dei 99: 241-251.

BRITISH COLUMBIA MINISTRY OF ENVIRONMENT, meine AND ParKS. 1997. In-
ternet URL: www.env.gov.be.ca/wld/biodiver.

pres Az 1997. Seonety Statistics on the: flora of repre Internet
URL: html

DEBOLT, ‘. AND B. MCCUNE. 1993. Lichens of Glacier National I Park, Mon-
tana. Bryologist 96: 192-204.

DUNWIDDIE, P. W. AND B. A. Sorrie. 1996. A flora of the vascular and non-
vascular plants of Nantucket, Tuckernuck, and Muskeget Islands. Rho-
dora 98: 94-98.

Ecan, R. S. 1987. A fifth checklist of the lichen-forming, lichenicolous and

allied fungi of the continental United States and Canada. Bryologist 90:
77-173.

EsSLINGER, T. L. AND R. S. EGAN. 1995. A sixth checklist of the liche
orming, lichenicolous, and allied fungi of the continental United sae
and Canada. Bryologist 98: 467-549

EVERSMAN, S. 1990. Lichens of Yellowstone National Park. Bryologist 93:
197-205

Faitu, D. BP. AND P. A. WALKER. 1996. How do indicator groups provide
information about the relative biodiversity of different sets of areas?: On
hotspots, complementarity and pattern-based approaches. Biodiversity
Letters: 3: 18—25.

GaLLoway, D. J. 1985. Flora of New Zealand, Lichens. P. D. Hasselberg,
Government Printer, Wellington, New and.

. 1992. Biodiversity: A lichenological perspective. Biodiversity and
Conservation 1: 312-323.

Gaston, K. J. 1996. Spatial covariance in the species richness of higher taxa,
Cha. 12. In: M. E. Hochberg, J. Clobert, and R. Barbault, eds., Aspects
of the Genesis and Maintenance of Biological Diversity. Oxford Univ.
Press, Oxford, England.

Gicpert, O. L. 1977. Lichen Conservation in Britain, Cha. 11. Jn: M. R. D.
Seaward, ed., Lichen Ecology. Academic Press, New York.

HarVARD UNIVERSITY HERBARIA. 1997. Internet URL: herbaria. harvard.

e ,

Hawxksworth, D. L. 1991. The fungal dimension of biodiversity: Magnitude,
significance, ona conservation. Mycol. Res. 95: 641—65

HEALY, A. J. AND E. Epcar. 1980. — of New Zealand, Vol. 3. Government
Printer, Wellington, New Zealan

ares J. E., ed. 1993. The aaa cere Higher Plants of California.
Univ. of California Press, Berkeley, C

Huston, 'M. A. 1994. Biological cnc ag "Cambridge Univ. Press, Cam-
bridge, England.

Kartesz, J. T. 1994. A Synonymized Checklist of the Vascular Flora of the

296 Rhodora [Vol. 101

United States, Canada, and Greenland, 2™4 ed., Vol. 1—Checklist. Timber
Press, Portland, ap

Ps ahienly S. Y., I. L. NAvrotskayA, S. D. ZELENKO, S. P. WASSER, AND
E. NEvo. 1996. The First Checklist of Lichen-Forming and Lichenicol-
ous Fungi of Israel. Kholodny Inst. Of Botany, Univ. of Haifa. Peledfus
Publ. House, Kyiv, Israel.

bigger og D. J. 1987. The Plant-Book, A Portable Dictionary of the Higher
Plants. Cambridge Univ. Press, Cambridge, Englan

eee B. AND M. J. MEFFORD. 1997. PC-ORD. Multivariate Analysis of

Moore, L. B. AND E. Epaar. 1970. Flora of New Zealand, Vol. 2. Govern-
ment Printer, Wellington, New Zealand.

PALMER, M. A. 1996. A strategic approach to the conservation of plants in
the United Kingdom. J. Appl. Ecol. 33: 1231-1240.

PHARO, E. J. AND A. J. BEATTIE. 1997. sy ce and lichen diversity: A

co
STATISTICS NETHERLANDS. 1997. Internet ae Be Ses

TALBOT, S. S., S. L. TALBOT, AND J. W. THOMSON. 1992. Lichens of the
Tuxedni Bivens Area, Alaska. Bryologist 95: 20-30.

. L. WELSH. 1995. Botanical Reconnaissance of the
Tuxedni Wilderness Area, Alaska. Biological Science Report 6, National
Biological Service, U. S. Department of the Interior, Washington, DC.

THORNE, R. T. 1992. Classification and geography of the flowering plants.
Bot. Rev. oa 225-348.

Tucker, S. C. AND W. P. JorpaNn. 1979. A catalog of California lichens.

Ee:

‘WEBB, ret W. R. SYKES, AND P. J. GARNOCK-JONES. 1988. Flora of New
Ze d, Vol 4. cys Division, D. S. I. R., Christchurch, New Zealand.
WEI, anaes 1991. An Enumeration of Lichens in China. International
ademic peng Beijin
WETMoRE, C. M. 1967. Lichens of the Black Hills of South Dakota and
Wyoming. Publication of the Museum, Michigan State Univ., Biological
Series, Vol. 3, No. 4, East Lansing, MI.
. 1983a. bien and Air Quality in Theodore Roosevelt National
Park. Final Report. Botany Dept., Univ. of Minnesota, St. Paul, MN
. 1983b. Lichens and Air Quality in Voyageurs National Park. Final
Report to the National Park Service. Botany Dept., Univ. of Minnesota,
St. Paul, MN.
. 1984. Lichens and Air Quality in Acadia National Park. Final Re-
port to the National Park Service. Botany Dept., Univ. of Minnesota,
St. Paul,
. 1985. Lichens and Air Quality in Isle Royale National Park. Final
Report to the National Park Service. Botany Dept., Univ. of Minnesota,
St. Paul, MN.
- 1988a. Lichens and air quality in Indiana Dunes National Lakeshore.
Mycotizon 33: 25-39.
. 1988b. sprog of Sleeping Bear Dunes National Lakeshore. Michi-
gan Bot. 27: 111-118.

1999] Bennett and Wetmore—Covariance of Floras 297

. 1989. Lichens and air quality in Cuyahoga Valley National Recrea-

tion Area, Ohio. Bryologist 92: 273-281.

. 1990a. ae of Apostle Islands National Lakeshore. Michigan

Bot. 29: 65-7

1990b. iaisaa of Pictured Rocks National Lakeshore. Michigan

Bot. 29: 19-26.

. 1991. Lichens and Air Quality in St. Croix National Scenic River-

way. Final Report to the National Park Service. Botany Dept., Univ. of

Minnesota, St. Paul, MN.

. 1992a. Lichens and Air Quality in George Washington Carver Na-
diaiat Monument. Final Report to the National Park Service. Plant Bi-
ology Dept., Univ. of Minnesota, St. Paul

——. 1992b. Lichens and Air Quality in Grand Portage National Monu-
ment. Final Report to the National Park Service. Botany Dept., Univ. of
Minnesota, St. Paul, MN.

AND J. P. BENNETT. 1992. NPLICHEN: A National Park Service Li-

chen Data Base. Final Report. Plant Biology Dept., Univ. of Minnesota,

St. Paul, MN.

. 1996. 1995 Lichen Studies in Apostle Islands National

Biological Service. Botany Dept., Univ. of Minnesota, St. Paul, MN.
AND 997. Lichens and Air Quality in Three Prairie Parks
Final Report. Biological Resources Division, U. S. Geological Survey,
Madison,
Witson, G. D. AND T. W. VINYARD. 1986. Changes in the lichen flora of
‘ipestone National Monument. Prairie Nat. 18: 9-14
ZOHARY, M. 1962. Plant Life of Palestine. Ronald Press, New York.

RHODORA, Vol. 101, No. 907, pp. 298-299, 1999

NEW ENGLAND NOTE

NOTES ON THE HABITS AND LIFE-HISTORY OF BIDENS
DISCOIDEA: AN EPIPHYTE IN MASSACHUSETTS
FLOODPLAIN PONDS

MATTHEW G. HICKLER
University of Massachusetts, Department of Biology, Amherst, MA 01003

Bidens discoidea (T. & G.) Britton is uncommon or under-
collected in Massachusetts and in need of attention from field
botanists to clarify its status in the state (Sorrie 1990; P. Somers,
pers. comm.). It resembles the common B. frondosa L. for which
it is easily mistaken. However, the two species are readily iden-
tified in the field by the number of outer involucral bracts: three
to five in B. discoidea, and five to ten in B. frondosa.

Bidens discoidea is an annual whose range covers much of the
eastern half of the United States and adjacent Canada (Gleason
and Cronquist 1991). Wiegand (1899) considered the species to be
“quite rare in New England” and more common in the western
part of its range where it grows on logs and stumps in lakes and
bogs. In the southeastern Coastal Plain it is found “usually on
fallen logs and stumps in swamps” (Fernald 1936) and is “‘con-
spicuous” in freshwater tidal swamps (Beaven and Oosting 1939).

Sorrie (1990) commented that he was aware of four extant
Massachusetts stations for Bidens discoidea and noted habitats as
ponds, oxbows, and buttonbush (Cephalanthus occidentalis 5)
swamps. He also noted an occurrence of it growing as an epi-
phyte, but provided no further details. Robert Bertin (pers.
comm.) recently found previously undocumented populations of
B. discoidea on the shores of a cluster of beaver ponds in Worces-
ter County, Massachusetts, most commonly growing on partially
submerged stumps and logs, but occasionally on shoreline soils.

Bidens discoidea is common on floodplain ponds along the Na-
shua River on land now or formerly part of the Fort Devens Mil-
itary Reservation in Worcester and Middlesex Counties, Massa-
chusetts. Here, the species is found almost exclusively growing as
an epiphyte on Cephalanthus occidentalis and was observed on 13
out of 15 floodplain ponds inventoried in 1995 and 1996. In these
ponds, water levels typically decline a meter or more between
spring and late summer, but levels fluctuate during the growing

298

1999] New England Note 299

season in response to mse patterns (M. Hickler, unpubl.
data). Shoreline vegetation in these ponds often includes dense

thickets of C. occi eon At least three species of moss [Cli-
maceum americanum Brid., Drepanocladus aduncus (Hedw.)
Warnst. var. kneiffi (Schimp. in B.S.G.) M6nk., and Dichelyma
capillaceum (With.) Myr.] grow on Cephalanthus stems, where
ey form dense tufts, concentrated around the normal high water

Bidens discoidea has a strategy for avoiding the stresses as-
sociated with unpredictable hydrology and light competition from
Cephalanthus in this habitat. The awned achenes, which are well
adapted for dispersal by hitchhiking on passing animals, are also
perfectly pre-adapted to lodge in the thick tufts of moss. Achenes
germinate in their mossy seedbeds after water levels begin to
recede in the spring but long before ground-level soil has drained.
The roots then follow the receding water toward the ground (M.
Hickler, pers. obs.). Perched high in the Cephalanthus stems, the
aerial portions of the plants are above the influence of fl ng
and in position to penetrate through the dense Cephalanthus can-
opy to where there is ample sunlight. By late summer, B. discoi-
dea plants can be seen throughout the Cephalanthus swamps with
their tops above the shrub canopy in full sunlight and roots pro-
jecting down, sometimes a meter or more, to the soil.

ACKNOWLEDGMENTS. Thanks to Roberta Lombardi and Sarah
Cooper-Ellis for moss identifications.

LITERATURE CITED

BEAVEN, G. FE AND H. J. Oostinc. 1939. Pocomoke Swamp: A study of a
cypress swamp on the Eastern Shore of Maryland. Bull. Torrey Bot. Club
66: 367-389.

FERNALD, M. L. 1936. Plants from the outer coastal plain of Virginia. Rhodora
38: 376—4.

GLEason, H. A. AND A. CRONQUIST. 1991. Manual of Vascular Plants of North-
eastern United States and Adjacent Canada, 2nd ed. The New York Bo-
tanical pape Bronx,

Sorrig, B. A. 1990. “Watch List”: Uncommon or Rare Massachusetts Plants.
naeteree No. 16, 260-10-300-4-C.R., Natural Heritage and Endangered
Species Program, Massachusetts Division of Fisheries and Wildlife, Bos-
ton, MA.

WIEGAND, K. M. 1899. Some species of Bidens found in the United States and
Canada. Rhodora 8: 399-422

RHODORA, Vol. 101, No. 907, pp. 300-301, 1999

NEW ENGLAND NOTE

A NEW BARNSTABLE COUNTY, MA, RECORD FOR
ASCLEPIAS PURPURASCENS

DONALD G. SCHALL
ENSR, 95 State Road, Buzzards Bay, MA 02532

Mario J. DiGREGORIO AND PAMELA POLLONI
Sabatia Inc., 107 Goeletta Drive, Hatchville, MA 02536

While inspecting the status of a small population of Rhodo-
dendron canadense (L.) Torr. present in a moist woodland habitat
on the edge of a shallow wetland depression in Falmouth, Mas-
sachusetts, we discovered three individuals of Asclepias purpur-
ascens L. (Asclepiadaceae) in the understory ground cover. The
species is found from New Hampshire to Virginia, west to Iowa,
Kansas, and Oklahoma, and north to Wisconsin (Gleason and
Cronquist 1991). Purple milkweed is identified as belonging to a
“Division 2; Regionally Rare Taxa” category in “‘Flora Conser-
vanda: New England” by Brumback and Mehrhoff et al. (1996)
with fewer than 20 current occurrences in New England. Purple
milkweed is a State Threatened taxon in Massachusetts with two
extant occurrences. In New Hampshire, Connecticut, and Rhode
Island, purple milkweed is listed as a State Historic taxon with
no extant populations. The taxon is not reported from Maine or
Vermont. Previous records for A. purpurascens on Cape Cod and
the Islands are rare with only a few occurrences documented dur-
ing the past decade (P. Somers, Massachusetts Natural Heritage
and Endangered Species Program, pers. comm.). A single speci-
men was collected in 1986 from a dry heathland community on
the Miacomet Plains on Nantucket (Sorrie and Dunwiddle 1996).
Two early records of A. purpurascens from dry oak forest habitat
in West Tisbury and Chilmark are referenced in The Flora of
Martha’s Vineyard published by the Martha’s Vineyard Sandplain
Restoration Project (1998). Despite repeated surveys performed
in conjunction with the New England Plant Conservation Pro-
gram (NEPCoP) sponsored by the New England Wild Flower
Society in Framingham, Massachusetts, the authors have been
unable to relocate a Barnstable County population discovered by

300

1999] New England Note 301

Richard LeBlond in 1989 under a transmission line corridor in
Brewster, Massachusetts. This species is not mentioned in ‘‘Notes
on the rare flora of Massachusetts’’ (Sorrie 1987).

The Barnstable County plants were first observed on July 8,
1998. A single terminal umbel comprised of 24 flowers atop a
pubescent peduncle was observed on the taller (SO cm height)
specimen. The smaller specimens did not produce inflorescences.
Distinguishing features included the bright magenta hoods (7
mm), which turned darker purple-red with age. The erect hoods
clearly surpassed the gynostegium and the short, incurved horns.
The opposite, elliptical leaves (15 cm) had distinct petioles, trans-
verse veins and an acuminate leaf tip. The stem was slightly hairy
while the undersurface of the leaf was covered with short, downy
hairs. The upper surface of the leaf was glabrous.

Associated species in the ground cover included Pyrola rotun-
difolia L. var. americana (Sweet) Fern., Gaultheria procumbens
L., Vaccinium angustifolium Aiton, and Lycopodium obscurum
under an open canopy of Pinus rigida Miller, Quercus alba L.,
and Q. velutina Lam. A locally rare fern, Osmunda claytoniana
L., occurred on the upland slope of the wetland depression inter-
mixed with O. cinnamomea L

LITERATURE CITED

BRUMBACK, W. E. AND L. J. MEHRHOFF, in collaboration with R. W. ENSER,
S. C. GAWLER, R. G. Popp, P. SOMERS, AND D. D. SPERDUTO, with assis-
tance from W. D. COUNTRYMAN AND C. B. HELLQUIST. 1996. Flora Con-
servanda: New England. The New England Plant Conservation Program
(NEPCoP) list of plants in need of conservation. Rhodora 98: 233-361.

GLeason, H. A. AND A. Cronquist. 1991. Manual of Vascular Plants of
Northeastern United States and Adjacent Canada, 2nd ed. The New York
Botanical Garden, Bronx, NY.

MARTHA’S VINEYARD SANDPLAIN RESTORATION PROJECT. 1998. The Flora of
Martha’s Vineyard. The Mary R. Wakeman Conservation Center, Vine-
yard Haven, MA.

Sorrig, B. A. 1987. Notes on the rare flora of Massachusetts. Rhodora 89:
113-196.

Sorrig, B. A. AND P. W. Dunwippie. 1996. The Vascular and Non-Vascular
Audubon Society, Massachusetts Natural Heritage and Endangered Spe-

cies Program, Nantucket Maria Mitchell Association, and the Nature
Conservancy, Nantucket,

RHODORA, Vol. 101, No. 907, pp. 302, 1999

NEW ENGLAND NOTE

CYPERUS MICROIRIA: A NEW ADDITION TO THE
FLORA OF CONNECTICUT

TAD M. ZEBRYK
63 Hillside Drive, East Longmeadow, MA 01028

Cyperus microiria Steudel (Cyperaceae). Hartford County:
Windsor, Huckleberry Road, waste area at town landfill, moist
acidic loamy fine sand, rare, 18 Sep 1998, Zebryk 5760 (NEBC,
EIU). Determined by Gordon C. Tucker, Eastern Illinois Univer-
sity.

While conducting a floristic inventory and rare plant survey at
Northwest Park and vicinity for the Town of Windsor, Connec-
ticut, an unusual Cyperus was noted among other ruderal species
at the adjacent Windsor Town Landfill. Bearing a distinct resem-
blance to C. iria L., a somewhat invasive Eurasian species com-
mon throughout the southeastern U.S., this unknown specimen
was determined to be C. microiria, an annual native to China,
Korea, and Japan.

Apparently a rare adventive in eastern North America, Cyperus
microiria has previously been reported in New York City, Phi-
ladelphia, and recently in Kentucky. The collection from Windsor
is only the second known from New England (G. Tucker, pers.
comm.), the first being from Wayland, Massachusetts (P. Ada-
konis s.n., 13 Sep 1979, Wayland, Middlesex County; MASs).

The landfill at Windsor serves as a haven and probable point
of dispersal for a large number of invasive introduced and native
species, including Cyperus esculentus L., Froelichia gracilis
(Hook.) Mog., Setaria glauca (L.) P. Beauv., S. geniculata (Lam.)
P. Beauv., S. viridis (L.) P. Beauv., Microstegium vimineum (Trin.)
A. Camus, and Cirsium arvense (L.) Scop. At the present time,
little is known about the potential for Cyperus microiria to be-
come a troublesome invasive weed, similar to C. rotundus L. in
the South, or the widespread C. esculentus. Certainly the small
population at Windsor, if it persists, is worth monitoring to eval-
uate the potential impact of this species in our region.

302

RHODORA, Vol. 101, No. 907, pp. 303-305, 1999
BOOK REVIEW

Proceedings of a Symposium on the Recovery and Future of the
Northeastern Forest, Connecticut College, April 12, 1997 ed-
ited by Robert A. Askins and Glenn D. Dryer. 1998. Pub-
lished in the journal Northeastern Naturalist, Volume 5,
Number 2, pp. 95-172. ISSN 1092-6194 $10.00 (paperback).
Published by collaborative effort based at the Humboldt
Field Research Institute, Steuben, ME (available from http:/
/maine.maine.edu/~eaglhill; mention this review and receive
a 20% discount).

On April 12, 1997, the Center for Conservation Biology and
Environmental Studies at Connecticut College, New London,
sponsored a symposium for land managers, conservationists, and
educators in environmental science, designed to assist in the de-
termination of whether biological diversity and ecological func-
tioning is restorable and sustainable. The seven presenters, a com-
mendable ensemble of some of the more notable ecologists in the
field today, have produced a symposium of papers which is both
thoughtful and informative. The overall viewpoint is one of in-
tegrative ecology (the belief that complex systems such as eco-
systems must be looked at as a whole, over long periods, to be
understood), however the reductionist perspective is also repre-
sented, as well as suggestions from environmental economists.

The take-home message of this symposium is clearly that
northeastern forests need to be evaluated and a balance struck
between their ecological and subjective social value, and then
proactively managed to foster and protect such states. The point
that nature is dynamic and therefore there is no historical state
which should serve as our restorative target, is often repeated.
Lesser themes of the conference include the need for long-term
research, the effects of air pollution on forest ecosystems, and the
need to improve the processes by which ecological research is
disseminated to managers and policy-makers. The conference ad-
mirably wrestles with the coexisting evidence of forests in met-
abolic decline, systemically speaking, while many forest species
are on the increase.

William A. Niering provides a good start with his overview of
the natural and anthropogenic agents affecting regional forests in
his paper ‘‘Forces that shaped the forests of the northeastern Unit-

303

304 Rhodora [Vol. 101

ed States.”” The impacts of human settlement, by far the predom-
inant influence, is recounted from the Indian to the post-colonial
period, and current threats such as pollution, introduction of ex-
otic species, and fragmentation of forests are cited.

David R. Foster and Glenn Motzkin follow by asserting the
importance of a historical perspective in the interpretation of for-
est landscapes for ecological conservation, management, and de-
velopment in “‘Ecology and conservation in the cree landscape
of New England: Lessons from nature’s history.” The authors
claim that while climate and elevation were the primary forces
shaping regional forests in precolonial days, past land-use and
edaphic factors exert the reigning influences on vegetative com-
position and structure today. They introduce the point that nature
has no static ideal; vegetative communities have no record of
long-term consistency, nor have regional floras shown any ten-
dency to revert to floras of the past. Mankind thus has strongly
influenced both past and future forest states.

ene E. Likens and Kathleen E Lambert discuss the critical
need for sustained research in their paper ‘““The importance of
long-term data in addressing regional environmental issues.”
They strongly present the danger of using short-term data to eval-
uate long-term patterns, the need for safeguarding long-term data
and research sites in perpetuity, and recommendations that ex-
perimental designs be adaptable to future concerns and not “‘ques-
tion-driven.’’ Also advocated is the use of long-term watershed
ecosystem research to guide sustainable forestry policy.

John M. Skelly takes the road less traveled with his clearly
reductionist perspective in “‘A brief assessment of forest health
in northeastern United States and southeastern Canada.” He ar-
gues that while air pollution may be a forest stressor, there has
been no hard evidence that regional forests are in decline. In
support of this view are cited two short-term and one ten-year
forest agencies study, which found no clear cause-effect relation-
ship between the tree mortality and pollution deposition.

“The epidemiology of forest decline in eastern deciduous
forests,” Orie L. Loucks elegantly and effectively refutes the re-
ductionist viewpoint. What begins as a discussion of the appro-
priate research framework for the study of complex systems ends
in a well-presented scientific argument concluding that air pol-
lution has inde en the cause of large-scale tree mortality in
the region. Along the way, the integrative versus reductionist ap-

1999] Book Review 305

proaches are discussed, and the systematic symptoms of “forest
decline”’ are defined.

Dina Franceschi and James R. Kahn present the economist’s
perspective in ‘“‘The potential contribution of economics to the
recovery of northeastern forests.”’ Their point is that the social
benefits of healthy forests need to be determined, and then poli-
cies providing economic incentives to landowners and managers
need to reflect these goals. As long as private benefits exceed the
public good, forests will continue to be developed, fragmented,
and polluted.

Lastly, John Kricher delivers a summary of sorts with *‘Noth-
ing endures but change: Ecology’s newly emerging paradigm,”
in which he states that human stewardship of natural systems is
essential. The concept of “‘nature’s balance”’ is a western philo-
sophical construct which must be dismissed so that proactive
goals for ecosystem management can be determined and
achieved. Clearly, the northeastern forests of tomorrow are being
shaped by the perspectives of land managers, conservationists,
and educators of today. This symposium does a commendable
job of representing these evolving perspectives.

—LESLIE TEELING, Department of Plant Biology, University of
New Hampshire, Durham, NH 03824.

RHODORA, Vol. 101, No. 907, pp. 306—308, 1999
BOOK REVIEW

Discovering the Unknown Landscape: A History of America’s
Wetlands by Ann Vileisis. 1997. xii+433 pp. illustrations,
photos, appendix, map, index. ISBN 1-55963-314-X $27.50
(cloth). Island Press, Washington, DC.

In the preface (p. xi—xii) of Discovering the Unknown Land-
scape: A History of America’s Wetlands, author Ann Vileisis states
that, ““The matter of wetlands and their conservation is not a matter
of science alone—but one of culture as well.” Building upon this
thesis, Vileisis examines the interactions between Americans and
their neighboring wetlands from colonial to modern times.
Throughout the narrative, readers learn how the 221 million acres
of wetlands that were once distributed across America were sys-
tematically reduced to approximately 102.3 million acres by the
1990s. Efforts to develop and exploit wetland habitats as well as
the more recent desire to conserve wetlands are examined within
the prevailing political, economic, and environmental trends of

erican society. From the harvesting of salt marshes by New
England colonists to the levee systems of the United States Army
Corps of Engineers, readers learn how various attitudes and poli-
cies permanently altered the complexion of the continent.

Concepts of wetland science are frequently discussed in the
text. However, the objective of the narrative is not to explain
details of wetland biology and hydrology, but instead to chart the
actions of society as the ecological values of wetlands became
better understood. Throughout Discovering the Unknown Land-
scape, the complex interactions of government agencies, politi-
cians, and private citizens are illustrated. The eighteen chapters
have titles such as, ““A Landscape on the Periphery,” “‘Wetlands
Portrayed and Envisioned,” “Federal Bulldozers and Draglines,”
“The Reagan Agenda Challenges Wetland Gains,” and “The
Promise of Restoration.” Each chapter is divided into several
subtopics relating different aspects of the chapter theme. Regions
that are revisited throughout the book include the Florida Ever-
glades, the bottomland swamps of Louisiana, the riparian wet-
lands of the Mississippi drainage, the prairie potholes of the upper
Great Plains, and the Central Valley of California. Some of the
topics discussed include:

306

1999] Book Review 307

* the early perceptions of wetlands, including those of writers
and artists

* the consequences of the Swamp Land Acts of the mid-1800s

contradictory federal policies, some of which promoted wet-

land reclamation for agriculture and economic development,

while other legislation encouraged wetland conservation

the continued degradation of the nation’s wetlands by a swell-

ing post-World War II population, and the increasing efforts

of conservationists at local, state, and federal levels

the Federal Water Pollution Control Act of 1972 (the Clean

Water Act) and the debate over the regulation of wetland

development through the interpretation of Section 404

* the environmental impacts of the Peagan administration, the
“no net loss’’ wetland directive of the Bush administration,
and the policies of the Clinton administration as well as the
104th Congress

Vileisis has provided a thorough summation of an extensive
and complex topic within American environmental history. The
narrative is organized well and reads smoothly despite the abun-
dance of agency acronyms and references to legislation that po-
tentially could make prose cumbersome. As one decade sets the
tone for the next, the reader gains an awareness of the historical
precedents that have contributed to contemporary wetland issues.

Discovering the Unknown Landscape has been extensively re-
searched. The 64 pages of notes organized by chapter are a useful
resource. The notes contain a wealth of information cited from
diverse sources ranging from technical government documents
and academic histories to the popular press. A 12-page index,
numerous archival photographs and illustrations, and the occa-
sional map and graph also enhance the text.

The one page appendix entitled “Some Common and Scientific
Names of Wetland Plants” consists of a wide spectrum of species
with both cosmopolitan (e.g., Phragmites australis and Typha
latifolia) and regional (e.g., Avicennia germinans and Cladium
jamaicense) distribution patterns. Among this list of plant species
there are some editorial problems, including a few misspellings
such as Lythrum salarica [sic] and some taxonomic confusion.
The scientific name Scirpus acutus includes the author citation
when all other species have the author omitted. Spartina pectinata
is placed in the list three times under various names; it is cited

308 Rhodora [Vol. 101

> 66

with the common names “‘black grass,” “‘sloughgrass”’ (under the
synonym S. michauxiana), and “‘prairie cordgrass.”” The common
name prairie cordgrass was paired with the apparently non-exis-
tent scientific name S. pectiana (see Kartesz 1994). Regarding
other common names, Nymphaea odorata is cited oddly as ‘‘wa-
ter lily tuber,’ and “sheep laurel” (Kalmia angustifolia), is er-
roneously paired with the scientific name for mountain laurel (K.
latifolia), an upland laurel species.

Discovering the Unknown Landscape has provided an important
service by placing our scientific knowledge of wetland values with-
in the framework of our nation’s history. Vileisis (p. 350) con-
cludes by stating that, “Informed by history, we can remember the
trade-offs already made and turn away from the mistakes and mis-
understandings of a time when we knew no better.”” This enhanced
perspective is a valuable complement to the wetlands dialogue that
too frequently finds human economics and development at odds
with environmental concerns. While reading the story of our
American wetlands it becomes painfully apparent that as a nation
we have not really “‘discovered the unknown landscape.”’ Instead,
by using our technological and engineering prowess, we have at-
tempted to conquer a vital feature of our natural topography that
too often has been viewed as a blight rather than a blessing.

Discovering the Unknown Landscape is an informative addi-
tion to the literature of the history, politics, and public perceptions
of American wetlands. At the conclusion of the first chapter, Vi-
leisis (p. 10) observes that, ‘‘Perhaps a newfound awareness of
wetlands can inspire and nourish a vision of stewardship for these
long-abused and misunderstood landscapes.” Discovering the
Unknown Landscape contributes significantly to the ongoing ef-
fort to elevate the importance of wetlands in our nation’s con-
science. Readers will gain a clear appreciation for the issues that
have defined the relationships between American culture and the
wetlands that are finally beginning to be appreciated and better
understood. For educators, conservationists, consultants, politi-
cians, or any reader with a general interest in the history of Amer-
ican wetlands, Discovering the Unknown Landscape is a thought-
provoking synthesis and a highly recommended resource.

LITERATURE CITED

Kartesz, J. T. 1994. A Synonymised Checklist of the Vascular Flora of the
United States, Canada, and Greenland. Timber Press, Portland, OR.

—C. Eric HELLQuIsT, 391 West Road, Adams, MA 01220.

RHODORA, Vol. 101, No. 907, pp. 309-310, 1999
BOOK REVIEW

Flora of Maine: A Manual for Identification of Native and Nat-
uralized Vascular Plants of Maine by Arthur Haines and
Thomas FE Vining. 1998. 837 pp. with 10 blank, numbered

pages for notes. ISBN 0-9664874-0-0 $45.00 plus shipping
(paperback). V. EF Thomas Co., Bar Harbor, ME.

Botanists in Maine can claim a number of luminaries over the
past two centuries. We begin with John Josselyn, who compiled
the first list of plants observed in Scarborough in 1672. Merritt
L. Fernald and his colleagues named our state botanical society
in honor of Josselyn a few years before joining with others in
Cambridge, Massachusetts, to create the New England Botanical
Club. The authors of the recently published Flora of Maine, Ar-
thur Haines and Thomas F Vining, acknowledge a nearly unbro-
ken thread of field-oriented catalogs and listings that have pro-
vided information for their work. This latest manual is the first
(nearly) complete flora.

Two years and two months seem hardly enough time to pro-
duce a state flora, yet Haines and Vining have called on years of
experience in the field, in university classrooms and laboratories,
and amongst a large number of colleagues and advisors to pro-
duce a credible and accessible volume. It is an essential volume
for the libraries of New England botanists and institutional li-
braries everywhere.

The most important element of a flora, for this reader, is its
keys. Every manual treats a different segment of the plant world
defined by a combination of factors, including political geogra-
phy, topography, taxonomic group, or the particular interests and
needs of readers. Haines and Vining have prepared keys to the
vascular plants native or naturalized to Maine, and they warn that
such a scope allows them to use characters for identification that
might not be appropriate elsewhere. Nevertheless, the keys to
families (following Judd et al. 1999) are sound and usable: well
written, segmented into logical groups, and based on easily rec-
ognizable field characters.

Keys to genera and species comprise essential characters wher-
ever possible. Complete descriptions of genera and species are
not found here as they are in Gray’s Manual (Fernald 1950) or
the Manual of Vascular Plants of Northeastern United States and

309

310 Rhodora [Vol. 101

Adjacent Canada (Gleason and Cronquist 1991). Yet the reader
can easily build such complete descriptions from the information
used to create the keys. Special notes appear for taxa that have a
designated rank of rarity following the criteria of the Maine Nat-
ural Areas Program.

The Flora of Maine should certainly be found on the desk or
in the satchel of Maine’s resident and visiting botanists. It may
be a model for botanists in neighboring New England states, and
perhaps it will inspire the long-overdue revision of our most im-
portant regional flora, Gray’s Manual (Fernald 1950). The Uni-
versity of Maine should be proud of the work of authors Arthur
Haines and Tom Vining.

LITERATURE CITED

FERNALD, M. L. 1950. Gray’s Manual of Botany, 8" edition (corrected print-
ing 1993). Dioscorides Press, Portland, OR.
GLEASON, H. A. AND A. CRONQUIST. 1991. Manual of Vascular Plants of
featieiern United States and Adjacent Canada. The New York Botan-
k

Jupp, W. S., C. S. CAMPBELL, E. A. KELLOGG, AND P. S. STEVENS. 1999. Plant
Systematics: A Phylogenetic Approach. Sinauer Associates, Inc., Sun-
derland, MA.

—W. DONALD Hupson, Jr., Chewonki Foundation, Wiscasset,
ME 04578-4822.

RHODORA, Vol. 101, No. 907, pp. 311-317, 1999
NEBC MEETING NEWS

March 1999, Thomas J. Rawinski, Director of Ecological Man-
agement at Massachusetts Audubon’s Center for Biological Con-
servation, addressed the Club on the topic ‘Travels through Vir-
ginia: Botanical Wonders and Conservation Victories.”’ It was a
partial accounting of his seven years away from New England,
or in his words, ‘‘a report back to the hive,”’ regarding his em-
ployment as an ecologist with the Virginia Division of Natural
Heritage, part of the state’s Department of Conservation and Rec-
reation. Using slide images and recounting many botanical dis-
coveries and new natural areas protected as a result of the Divi-
sion’s efforts, he gave us an overview of the state’s natural areas
and botanically diverse ecosystems. He reminded us of how much
L. Fernald had loved Virginia, noting that Fernald added more
new species to his 8th edition of Gray’s Manual of Botany from
Virginia than from Newfoundland, another area he had explored
extensively.

Contrasting Virginia with New England, Rawinski said Virgi-
nia has only two natural lakes, lacks some northern taxa such as
Chamaedaphne, and is nearly devoid of paper and gray birch. As
evidence of a richer flora than New England, he noted that there
were 25 oaks, 8 pines, 6 magnolias, 25 Rhynchospora spp., 13
Vaccinium spp., and 10 Trillium spp., plus representation by fam-
ilies such as the Bromeliaceae and Loganiaceae. Virginia endem-
ics include three species of Clematis: C. addisonii, which occurs
on dolomite; C. coactilis, a species found on both dolomite and
shale; and C. viticaulis, a narrow endemic found only on shale
barrens. Other endemics include Helenium virginicum, a species
of acid ponds in the Shenandoah Valley, and /liamna corei, a
species for which they found fire worked well as a management
tool.

The clearly defined physiographic provinces of the state helped
Rawinski orient us to the state’s major geological and climatic
regions and to the locations of unique habitats for plants within
them. Elevations range from the 5700 ft. high Mt. Rogers in the
Blue Ridge Mountains in southwestern Virginia to sea level
where one can find extensive tidal marshes. He compared the
Piedmont of Virginia to Worcester County, Massachusetts, point-
ing out that neither is diverse in habitat types, but that each pos-
sesses some interesting ones, such as those with diabase bedrock.

311

312 Rhodora [Vol. 101

Botanical hot spots are clustered in habitats such as shale barrens,
sea-level fens, and dolomite outcrops: types found primarily in
the eastern or western parts of the state. Using habitat character-
istics as primary indicators, he and colleagues located 30 new
state records, such as Carex arctata and Sporobolus heterolepis,
between 1990 and 1997. Recent funding of 11.5 million dollars
through a bond bill has allowed the Department to add over 20
new natural areas to its preserve system.

Rawinski highlighted certain ecosystems. More than 500 po-
tential shale barrens were identified by the Heritage Division;
they typically occur on steep hillsides undercut by streams. An
abundance of limestone in the Shenandoah Valley and elsewhere
has resulted in some notable dolomitic cliffs and, in the south-
western corner of the state, some calcareous glades with taxa such
as the newly described clover species, Trifolium calcaricum. Do-
lomite glades supported the globally rare Echinacea laevigata,
which can be found growing in loamy, dolomitic soil with prairie
taxa such as Castilleja coccinea and Senecio plattensis. A priority
for protection in Rawinski’s eyes was an ultramafic barren (i.e.,
a serpentine-like area with high magnesium levels) in the Pied-
mont supporting several disjunct and rare species. Buffalo Moun-
tain, a monadnock in the Blue Ridge, supported a diversity of
vegetation associations and herbaceous species, including nine
rare species for the state. Rawinski postulated that the thin soil
mantle and open glade habitat is maintained by a natural defi-
ciency of clay, which facilitates lateral movement of water and
washing of any deposited soil. Ultramafic fens are another botan-
ical hot spot in Virginia, providing habitat for 20 state-listed rare
species, including a state record discovery: Tofieldia glutinosa.
A truly significant area in the Piedmont is Fort Pickett Military
Reservation, where frequent fires have maintained a population
of the very rare sumac, Rhus michauxii, it occupies hundreds of
acres, making it by far the largest known population.

The Coastal Plain, as in New England, has many ponds, but
in Virginia they are sinkhole depressions over 100,000 years old.
Here one can find large overcup oaks, Quercus lyrata, and rare
herbs such as Carex joorii, Hottonia inflata, Sabatia campanu-
lata, and Chelone cuthbertii. In an especially dry year, ten new
Fimbristylis perpusilla records showed up at pond sites. Other
coastal plain communities of special interest are sand hills with
longleaf pine, pocosins or shrub bogs, sea level fens, and cypress-

1999] NEBC Meeting News 313

tupelo swamps, where — big-eared bats can be found in
cavities of the ancient tree

For more information on Mirginta natural areas and biota, Tom
Rawinski advised seeking out the Virginia Department of Con-
servation and Recreation’s web site.

April 1999, Michael Donoghue introduced the ‘“‘NEBC 1999
Distinguished Speaker,”’ Dr. Peter Raven, Director of the Missouri
Botanical Garden. Accomplishments and qualities mentioned in-
cluded (1) his ability to organize and galvanize people around
ideas and visions, (2) his authorship of The Biology of Plants,
(3) his collaborative research on the Onagraceae as a model for
systematic botany, (4) his leadership in coordinating the Flora of
China project, and (5) his leadership in conservation of biological
diversity, including serving on the President’s Commission on
Science wa Technology and co-authoring a paper entitled

““Teamin Life,’ a statement on the need and mechanisms
for preserving biodiversity.

Dr. Raven addressed the topic, “Plant Conservation Globally
and Locally.”” He explained that his approach would be to paint
the broadest picture possible of the current crisis in biological
conservation around the world and why the crisis exists. His main
objective was to stimulate our thinking about these issues and
invite a dialogue about strategies for combating the problem. Ra-
ven’s broadest picture included a review of 3.8 billion years of
biological evolution on the earth and the five major extinction
events that have influenced its pathways to the present. The first
three extinction events occurred when life was restricted to the
marine world. He pointed out that terrestrial life began 430 mil-
lion YBP, at a time equivalent to 90% of the way through the
time-line of earth’s existence. He emphasized the importance of
cyanobacteria in making colonization of terrestrial habitats pos-
sible by changing the earth’s atmosphere to an oxidizing one. The
resulting increase in oxygen produced by their photosynthetic ac-
tivities over 3 billion years made possible the production of a
stratospheric ozone layer that allowed the ancestors of the four
groups dominant on land at the present time (arthropods, fungi,
terrestrial vertebrates, and plants) to colonize terrestrial habitats.
The fourth great extinction event occurred at the end of the Perm-
ian, about 280 YBP, impacting the earth’s first forests and early
dinosaurs. In the following Mesozoic Era, dinosaurs and cycads

314 Rhodora [Vol. 101

flourished and angiosperms evolved, making life much more di-
verse than previously.

About million YBP, at the end of the Cretaceous Period,
the fifth great extinction occurred, presumably as the result of a
large meteorite crashing into the earth off what is now the Yu-
catan Peninsula. The collision created an opaque cloud around
the globe that impeded photosynthesis and, according to estimates
by David Raup et al., eliminated two-thirds of terrestrial species
in a short period of time. At that point, Raven estimated loosely
that the number of eucaryotic organisms remaining may have
numbered between 500,000—700,000. It took approximately ten
million years for life to recover, and the resulting evolutionary
pathways led to the evolution of most current groups of organ-
isms. Today, according to a 1997 paper by Sir Robert May pre-
sented at the National Forum on Biodiversity at the National
Academy of Sciences, the number of eucaryotic species can be
estimated conservatively at about seven million. Of these, only
about one in four has a valid name. In the tropics, the ratio is
much less, around one in twenty. Even for the described species
of organisms our knowledge is extremely limited; many are
known only from a single specimen at the bottom of a museum
vial. No one can give a plausible estimate of the number of pro-
caryotic organisms. One gram of soil in a Norwegian beech forest
is estimated to have 5,500 species of bacteria, more than the total
number of species recognized formally from the entire world, and
how these figures relate to other ecosystems around the world, or
to the total number of bacterial species, is unknown. Even more
poorly known, Raven says, is the multitude of relationships that
mediate the flow of energy through the globe’s ecosystems and
other aspects of their functioning.

Bringing humans into the picture, Raven drew attention to our
Homo erectus ancestors who migrated out of Africa and discov-
ered fire-making, causing some low-scale disturbances approxi-
mately 1.5—2 million YBP. Homo sapiens appeared on earth about
200,000 YBP and arrived in the New World 14,000—16,000 YBP.
The cultivation of crops began at about 10,000 YBP at a number
of widely-scattered centers, when there may have been only sev-
eral million people globally, a population equivalent to that of
the Greater Boston area today. Agriculture allowed for a reliable
food source, and by the time of Christ the earth’s population had
grown to around 120—150 million. By the Renaissance, it had

1999] NEBC Meeting News ats

grown to 0.5 billion, and by the time of Thomas Malthus, who
speculated at the start of the Industrial Revolution that human
populations would outstrip agriculture’s ability to produce food,
about 1 billion people were walking the earth. By 1950, our num-
bers had increased to 2.5 billion, and now 50 years later, the
earth’s population has reached nearly 6 billion, bringing even
greater importance to questions of sustainability.

*‘Sustainability and biodiversity are two sides of a coin,’’ Ra-
ven said. Can the human world sustain itself while maintaining
global biological diversity? The results of the last 50 years are
not encouraging. One-fourth of the world’s topsoil has been lost
and one-third of the world’s forests have been destroyed since
World War II. There has been a drastic increase in extinction
rates. It is estimated that extinction rates have increased 100 X
since the Renaissance and are 1000 X background rates, based
on fossil records. The rates are accelerating, according to extinc-
tion models developed by Stuart Pimm et al. using island bio-
geography theory, and may reach 10,000 X in the next century.
Over the next 25 years, they estimate that one-third of tropical
organisms will become extinct or be on the way to extinction,
and that by the end of the next century, three-fourths of all trop-
ical organisms and two-thirds of the worldwide total will be gone
or on the way to extinction. Homo sapiens, Raven says, is driving
an extinction event comparable to the scope of the fifth major
extinction event 65 million years ago. Nothing could be as dam-
aging to the future of our species, primarily because of our direct
dependency on other living organisms. The 350,000 species of
photosynthetic organisms—plants, algae, and a few bacteria—are
responsible for all productivity on earth, and human beings obtain
all their food from plants directly and indirectly. Another anthro-
pocentric reason for preserving biodiversity is that three-fourths
of humanity depends directly on biodiversity, mostly plants, for
its pharmacopoeia while the remaining quarter go to drug stores
and derive such benefits indirectly. Why say the 21st century will
be the “Age of Biology,”’ Raven asks, if all of the organisms are
going down the drain? Where will we get all of the organisms to
create new products or to use in new sustainable systems, or for
that matter to use in bio-engineering new biological products or
life forms? He cautions us to heed Aldo Leopold’s advice and
follow the “‘first rule of intelligent tinkering” by ‘saving all of
the cogs and wheels.”

316 Rhodora [Vol. 101

Raven asks, ‘“‘What things are in the way of fixing the prob-
lem?’ One is the sovereignty and pride of nations that inhibit our
ability to pay attention to one another internationally and establish
global solutions. He cites the United States’ failure to sign the
‘International Convention on Biological Diversity’ as a prime
example. A second appears to be greed and waste by the devel-
oped world, because Raven described the industrialized nations
as possessing 20% of the world’s population and 85% of the
world’s wealth, while creating 80—90% of its pollution. In the
world today, 360 billionaires have wealth equal to what two bil-
lion of the poorest people earn in a year. The people at the low
end of the economic spectrum are totally disenfranchised, which
denies the rest of the world the potential benefit of their wisdom
and creativity. We simplify when we say “‘over-population”’ is
the problem globally. For instance, Brazil and Mexico have had
population control policies for 20 years and have slowed popu-
lation growth and improved education for women, whereas the
U.S. has no population policy, despite a doubling of its population
in the past 50 years and a standard of living 30—40 times that of
Brazil or Indonesia. Because of our consumptive standard of liv-
ing, the impact on the environment of doubling the U.S. popu-
lation (adding 135 million people in 50 years) is equivalent to
adding 4 billion people to populations in Brazil or Indonesia.

We do not need to waste at the levels we do. The United States
wastes twice as much per capita as in Europe. We are living as
if there is no tomorrow and in denial that our economy is related
to the rest of the world. What can we do to help create a more
sustainable world and slow the loss of biological diversity? Ra-
ven’s answers include: (1) be leaders in showing the way rather
than demanding that the third world lead the way, (2) pay atten-
tion to internationalism by convincing others that the 80% of the
world’s people living in non-industrialized countries are of deep
and profound importance to us, (3) vote and encourage others to
do so, (4) support conservation groups you are congenial with
Se aie and then support sustainability, and (5) think

t what you are doing personally and make wise choices.
Pa says, “Think about what is just, what is stable, what is
sustainable. Think about a world within which biological diver-
sity, cultural diversity, beauty, music, poetry, philosophy, litera-
ture, and all the things we value and cherish can coexist. What
do we do to create a world that will maintain these things?” We

1999] NEBC Meeting News a7

can be optimistic or pessimistic amidst the ‘gloom and doom”
that we face. “Yes, the world will become more homogeneous
and less diverse,” Raven acknowledges. But the future depends
on how we live now, he says. “If you want to be optimistic, do
so because of your own determination to do something about it,”
says our 1999 saci pala Speaker, as he leads the Club for-
ward into its second century

—PAuL Somers, Recording Secretary

ANNOUNCEMENT

NEW ENGLAND BOTANICAL CLUB
GRADUATE STUDENT RESEARCH AWARD

The New England Botanical Club will offer $2,000 in support
of botanical research to be conducted by graduate students in
2000. This award is made annually to stimulate and encourage
botanical research on the New England flora, and to make pos-
sible visits to the New England region by those who would not
otherwise be able to do so. It is anticipated that two awards will
be given, although the actual number and amount of awards will
depend on the proposals received.

The award will be given to the graduate student submitting the
best research proposal dealing with systematic botany, biosyste-
matics, plant ecology, or plant conservation biology. Papers based
on the research funded must acknowledge the NEBC’s support.
Submission of manuscripts to the Club’s journal, Rhodora, is
strongly encouraged.

Applicants must submit three copies of each of the following:
a proposal of no more than three double-spaced pages, a budget,
and a curriculum vitae. Two letters in support of the proposed
research, one from the student’s thesis advisor, should be sent
directly to the Awards Committee by sponsors. All materials
should be sent to: Awards Committee, The New England Botan-
ical Club, 22 Divinity Avenue, Cambridge, MA 02138-2020. Pro-
posals and supporting letters must be received no later than March
1, 2000. The recipient(s) will be notified by April 30, 2000.

Two Graduate Student Research Awards were given in 1999.
Joel Gerwin of the University of Massachusetts at Boston re-
ceived support for his proposal entitled “‘Long-term effects of
forest fragmentation on genetic diversity of red oak (Quercus
rubra L.): A comparison of old-growth and secondary forests.”
Also chosen for an award was Julie Ellis of Brown University,
whose proposal was entitled ‘“The role of nesting seabirds in
structuring New England coastal plant communities.”

318

ANNOUNCEMENT

HUMBOLDT FIELD RESEARCH INSTITUTE PRIZE

The New England Botanical Club is offering a prize for the
best essay of 500 words or fewer on the theme ‘‘How I would
benefit from an Eagle Hill Seminar.’”’ This prize is offered in
conjunction with the Humboldt Field Research Institute, and con-
sists of tuition for a week-long Eagle Hill Field Seminar or Work-
shop in Steuben, Maine. In return for a donation from the Club
of a set of Rhodora back-issues, the Institute has reciprocated
with the donation to the Club of this prize. The contest is open
to any member of the NEBC. Please submit three copies of your
essay before December 31, 1999. Essays should be mailed to:
The New England Botanical Club, ATTN: Eagle Hill Essay, 22
Divinity Avenue, Cambridge, MA 02138. The winner will be
notified in advance and announced at the March, 2000, Annual
Meeting.

219

INFORMATION FOR CONTRIBUTORS TO RHODORA

Submission of a manuscript implies it is not being considered for
publication simultaneously elsewhere, either in whole or in part.

TITLE, AUTHOR(S), AND ADDRESS(ES): Center title, in capital
letters. Omit authors of scientific names. Below title, include au-
thor(s) name(s), affiliation(s), and address(es). If “current address”
is different, it should follow immediately below, not as a footnote.

der. Each reference cited in the text must be in the Literature Cited.
Cross-check spelling of author(s) name(s) and dates of publication.
Literature citations in the text should be as follows: Hill (1982) or
(Hill 1982). For two or more authors, cite as follows: Angelo and
Boufford (1996) or (Angelo and Boufford 1996). Cite several refer-
ences alphabetically by first author, rather than chronologically. With-
in parentheses, use a semicolon to separate different types of citations
(Hill 1982; Angelo and Boufford 1996) or (Figure 4; Table 2).

FLORAS AND TAXONOMIC TREATMENTS: Specimen citation
should be selected critically, especially for common species of broad

320

INFORMATION FOR CONTRIBUTORS 321

distribution. Keys and synonymy for systematic revisions should be

taxon should carry a Latin diagnosis (rather than a full Latin descrip-
tion), which sets forth succinctly how the new taxon differs from its
congeners.

THE NEW ENGLAND BOTANICAL CLUB
22 Divinity Avenue
Cambridge, MA 02138

To join, please fill out this membership application and send
with enclosed dues to the above address.

Regular Member 35.00
Family Rate $45.00
Student Member $25.00

For this calendar year
For the next calendar year

Name

Address

City & State Zip

Phone FAX

Special interests (optional):

Elected Officers and Council Members for 1999—2000:

President: David S. Conant, Department of Natural Sciences,
Lyndon State College, Lyndonville, VT 05851
Vice-President (and Program Chair): Lisa A. Standley, Vanasse
Hangen Brustlin, Inc., 101 Walnut St., P.O. Box 9151, Wa-
tertown, MA 02272
Corresponding Secretary: Nancy M. Eyster-Smith, Department
of Natural Sciences, Bentley College, Waltham, MA 02154-
4705
Treasurer: Harold G. Brotzman, Box 9092, Department of Bi-
ology, Massachusetts College of Liberal Arts, North Adams,
MA 01247-4100
Recording Secretary: Paul Som
Curator of Vascular Plants: a Angelo
Assistant Curator of Vascular Plants: Pamela B. Weatherbee
Curator of Nonvascular Plants: Anna M Reid
Librarian: Leslie J. Mehrhoff
Councillors: W. Donald Hudson, Jr. (Past President)
Arthur V. Gilman 2000
Karen B. Searcy 2001
David Lovejoy 2002
Jennifer Forman (Graduate Student Member) 2000

Appointed —
avid E. Boufford, Associate Curator
ae R. Sullivan, Editor-in-Chief, Rhodora

Internet Archive Audio

Featured

Top

Images

Featured

Top

Software

Featured

Top

Texts

Featured

Top

Video

Featured

Top

Mobile Apps

Browser Extensions

Archive-It Subscription

Save Page Now

Full text of "Rhodora"

See other formats